Xác đỊnh và thiẾt kẾ khung biẾn nẠp nhẰm loẠi bỎ gen translin Ở nẤm Mucor circinelloides



tải về 45.01 Kb.
Chuyển đổi dữ liệu30.08.2016
Kích45.01 Kb.
Xác đỊnh và thiẾt kẾ khung biẾn nẠp nhẰm loẠi bỎ gen translin Ở nẤm Mucor circinelloides

Triệu Anh Trung1* và Francisco E. Nicolás2



1 Khoa Sinh học, trường Đại học Sư phạm Hà Nội, 2 Khoa Sinh học, trường Đại học Murcia, Tây Ban Nha.

* Email: trungta@hnue.edu.vn



Tóm tắt. ARN can thiệp (RNA interference, RNAi) là một cơ chế điều hòa sự biểu hiện của gen phổ biến ở hầu hết các loài sinh vật nhân chuẩn; trong đó diễn ra sự ức chế biểu hiện gen dựa trên các trình tự bổ sung đặc hiệu. Trong đó, enzyme Dicer đóng vai trò cắt các phân tử ARN mạch kép tạo ra các phân tử ARN ngắn (siRNA) khoảng 20-25 nt, là tác nhân hỗ trợ bộ máy phân huỷ các mARN bổ sung với nó. Bộ máy này có protein Argonaute là thành phần chính. Dẫn đến ngăn chặn sự biểu hiện của gen tương ứng. Ở nấm sợi M. circinelloides, các nghiên cứu đã chỉ ra sự tồn tại của ít nhất hai cơ chế ARN can thiệp cần hoặc không cần sự tham gia của Dicer. Translin là một gen đã được chứng minh tham gia vào cơ chế ARN can thiệp bằng cách loại bỏ mạch mã hóa trong phân tử siRNA mạch kép ở động vật. Nghiên cứu này nhằm tìm kiếm gen mã hóa protein Translin và xây dựng khung biến nạp để tạo dòng đột biến gen này ở nấm M. circinelloides. Các dòng đột biến này sẽ được sử dụng cho các phân tích chức năng của Translin ở nấm Mucor.

Từ khóa: ARN can thiệp (RNAi), ARN mạch ngắn, Mucor circinelloides, Translin, C3PO

  1. Mở đầu

ARN can thiệp (RNA interference, RNAi) là một cơ chế điều hòa hoạt động của gen phổ biến ở hầu hết các loài sinh vật nhân chuẩn trong đó diễn ra sự ức chế biểu hiện gen dựa trên các trình tự bổ sung đặc hiệu. Cơ chế này lần đầu tiên được Fire và Mello mô tả ở loài giun tròn Caenorhabditis elegans [3]. Các hiện tượng tương tự cũng được mô tả ở các nhóm sinh vật khác, như hiện tượng “đồng ức chế” ở thực vật [8] và “dập tắt” ở nấm Neurospora crassa [12]. ARN can thiệp không những có vai trò quan trọng trong việc bảo vệ sự nguyên vẹn của hệ gen chống lại sự xâm nhập của các virus, transposon và plasmid, mà còn tham gia vào nhiều quá trình sinh học khác nhau của tế bào [1].

Cơ chế phân tử của ARN can thiệp khá đa dạng. Tuy nhiên, chúng đều có một số nét chung, khởi đầu là sự hình thành của một phân tử ARN mạch kép (dsRNA). Phân tử này sẽ bị cắt bởi một loại enzyme đặc hiệu là Dicer thuộc họ RNase III, tạo thành các đoạn ARN can thiệp ngắn, mạch kép (small interfering RNA, siRNA) hoặc microRNA (miRNA) có độ dài từ 20-25 nucleotit, gọi chung là ARN mạch ngắn (small RNA, sRNA). Các phân tử ARN ngắn này sẽ được chuyển tới phức hợp RISC (RNA-induced Silencing Complex). Tại đây, mạch mã hóa của ARN ngắn sẽ bị loại bỏ, chỉ còn lại mạch đối mã. Phức hợp RISC sẽ sử dụng mạch đối mã còn lại để nhận biết và phân hủy các phân tử mARN có trình tự bổ sung với nó. Kết quả dẫn đến sự ức chế biểu hiện của gen tương ứng. RdRP (RNA-dependent RNA Polymerase) là enzyme có chức năng khuếch đại các phân tử ARN mạch ngắn hoặc tạo thành các dsRNA sử dụng khuôn là các phân tử ARN mạch đơn (ssRNA) và kích hoạt cơ chế ARN can thiệp [5].

Nấm Mucor circinelloides thuộc lớp Nấm tiếp hợp (Zygomycetes) là một trong những mô hình lý tưởng trong các nghiên cứu sinh tổng hợp carotenoid và ARN can thiệp. Nó có thể bị tác động của cơ chế ARN can thiệp làm ức chế biểu hiện gen khi biến nạp bằng các vector mang các cấu trúc tạo thành dsRNA hoặc các plasmid tự tái bản. Kết quả là sự tích lũy của hai nhóm siRNAs có kích thước 21 và 25 nt từ cả hai loại mạch mã hoá và đối mã [11]. Hai enzyme Dicer (dcl1 và dcl2) và hai enzyme RdRP (rdrp1 và rdrp2) đã được xác định và nghiên cứu chức năng [2, 9-11]. Trong đó, dcl2 đóng vai trò chủ đạo trong cơ chế ARN can thiệp kích hoạt bởi gen ngoại lai và hình thành hai nhóm ARN mạch ngắn đối mã [2]. Gần đây, các phân tích giải trình tự ARN ngắn đã cho thấy trong tế bào của nấm M. circinelloides có bốn loại ARN ngắn khác nhau, được hình thành với sự tham gia của các thành phần enzyme khác nhau. Điều thú vị là phần lớn trong các ARN mạch ngắn này được hình thành từ các exon (exonic siRNA, ex-siRNA) và điều hoà sự biểu hiện của các gen mã hoá protein [10]. Gần đây, một cơ chế phân hủy mRNA đặc hiệu không phụ thuộc vào Dicer mới được phát hiện và có trách nhiệm kiểm soát sự biểu hiện của hơn 500 locus trong hệ gen của M. circinelloides [15].

Translin cùng với TRAX (Translin Associated Protein X) tạo thành phức hợp C3PO (component 3 promoter of RISC), phức hợp này tham gia vào cơ chế ARN can thiệp ở một số loài. Translin đã được chứng minh tham gia vào việc loại bỏ một mạch đơn (mạch mã hóa) trong phân tử siRNA trong phức hệ RISC ở ruồi dấm D. melanogaster [7], nhưng protein này chỉ tham gia vào quá trình trưởng thành của tRNA mà không đóng vai trò quan trọng trong cơ chế ARN can thiệp ở nấm N. crassa [6]. Nghiên cứu này nhằm tìm kiếm gen mã hóa Translin trong hệ gen của M. circinelloides, đồng thời thiết kế khung biến nạp nhằm loại bỏ gen này ra khỏi hệ gen của nó. Các thể đột biến thu được sẽ được sử dụng cho mục đích nghiên cứu chức năng của Translin ở nấm Mucor.



  1. Vật liệu và phương pháp nghiên cứu

    1. Các dòng nấm và điều kiện nuôi cấy

Trong nghiên cứu này, chúng tôi đã sử dụng dòng nấm khuyết dưỡng leucine R7B được phân lập từ M. circinelloides f. lusitanicus CBS 277.49 (syn. Mucor racemosus ATCC 1216b) làm dòng kiểu dại. Các dòng nấm được nuôi cấy ở 26OC trong môi trường YNB, YPG hoặc MMC [9].

    1. Các plasmid và vi khuẩn

Các thí nghiệm tách dòng sử dụng các plasmid pGEMT-easy (áp dụng với kỹ thuật nhân dòng TA) và/hoặc plasmid pBluescript SK+ (pBS). Plasmid pEPM1 mang gen marker pyrG có hai trình tự nhận biết của BamHI ở hai đầu. Tất cả các plasmid đều có gen marker là AmpR kháng ampicillin. Các dòng E.coli mang vector tái tổ hợp được chọn lọc trên môi trường LB có bổ sung ampicillin và X-gal (nếu cần). Các thí nghiệm nhân dòng plasmid được tiến hành trên vi khuẩn E. coli chủng DH5α.

    1. Các kỹ thuật phân tích ADN

Phương pháp tách chiết ADN hệ gen được tiến hành theo mô tả của Nicolás và cs [9]. Các phản ứng PCR sử dụng enzyme Biotaq DNA polymerase để nhân dòng TA. Các phản ứng cắt ADN bằng enzyme giới hạn và phản ứng nối sử dụng T4 DNA ligase (Thermo Scientific) theo hướng dẫn của nhà sản xuất.

Plasmid được biến nạp vào tế bào khả biến E.coli DH5α theo phương pháp sốc nhiệt [13] và được tách chiết bằng bộ kit GeneJET plasmid Miniprep (Thermo Scientific). Tinh sạch các phân đoạn ADN từ gel agarose bằng bộ kit StrataPrep DNA Gel Extraction của hãng Agilent Technologies theo hướng dẫn của nhà sản xuất.

Kỹ thuật biến nạp bằng xung điện vào tế bào trần của M. circinelloides được tiến hành theo mô tả của Gutiérrez A. và cs [4]. Kỹ thuật này áp dụng cơ chế tái tổ hợp đồng dạng nhằm thay thế các gen đích bằng gen marker chọn lọc. Ở nấm M. circinelloides, hai gen marker phổ biến nhất là pyrGleuA.

Để khẳng định việc nhân dòng là chính xác và không có đột biến điểm, các đoạn ADN được nhân dòng đã được giải trình tự tại trung tâm phân tích SACE của Đại học Murcia, Tây Ban Nha. Các trình tự ADN được phân tích sử dụng các chương trình của JGI (http://genome.jgi.doe.gov/), EMBL-EBI (http://www.ebi.ac.uk/) và NCBI (http://www.ncbi.nlm.nih.gov/).



  1. Kết quả nghiên cứu và thảo luận

    1. Xác định gen translin ở nấm M. circinelloides

Để tìm kiếm các gen translin ở nấm M. circinelloides, chúng tôi đã sử dụng trình tự axit amin của protein Translin ở nấm N. crassa (NCU06664, 239aa) [6] để tìm kiếm các trình tự axit amin tương đồng bằng phần mềm BLAST trên cơ sở dữ liệu hệ gen và protein của nấm M. circinelloides (JGI Mucor circinelloides CBS277.49 v2.0).

Kết quả tìm kiếm cho thấy chỉ có 1 gen duy nhất được phát hiện tương đồng với gen translin ở N. crassa, là gen có ID 189520 (scaffold_04:1245218-1248806). Gen này có kích thước 1089 bp, bao gồm 6 exon và 5 intron. Protein 189520 có kích thước 240 aa, trong đó chỉ có 1 domain Translin được phát hiện dựa trên cơ sở dữ liệu Conserved Domains của NCBI (Hình 1).





Hình 1. Cấu trúc của gen translin ở nấm M. circinelloides (ID 189520). (A) Gen translin có chiều dài 1089 bp, các chữ số cho thấy độ dài các exon và intron. (B) Protein 189520 có kích thước 240 aa, trên đó chỉ có 1 domain Translin được phát hiện.

    1. Thiết kế mồi

Các mồi được thiết kế dựa trên trình tự gen đích đã được xác định trong cơ sở dữ liệu JGI. Với mục đích xây dựng khung biến nạp gồm 2 vùng trước và sau gen (kích thước nhỏ nhất khoảng 1kb) gắn vào 2 đầu của marker chọn lọc. Khung biến nạp này được tạo thành bằng các phản ứng PCR hỗn hợp. Nên chúng tôi đã thiết kế các cặp mồi với vị trí như hình 2.



Hình 2. Sơ đồ vị trí các mồi được sử dụng trong nghiên cứu.

Các đoạn trình tự được lựa chọn để thiết kế mồi đảm bảo các điều kiện: ít vùng lặp lại, tỷ lệ GC không thấp hơn 40%, Tm tối thiểu đạt 60oC.



Bảng 1. Trình tự các mồi được sử dụng trong nghiên cứu.

Tên mồi

Trình tự mồi (5’-3’)

F189ups

TTTGTGCTCCAGCGACAGAAATGAGGTAGC

R189dow

CATAGATGACAGGTGTTTCGACCAAGGGGA

F189

ACGCTGCTGCCTTCTCCGAATTCCATGTG

R189

TTGGGCAGCTTGTTGTGCTTGTTGAGCTAC

R189-pyrg

CAAGTACCAATGCTGAGGCAAGCCAACCACTCAGGTCAAGGTCCC

F189-pyrg

CGATAGCATGGCCAGTGTACCACGGTGGGAATGATGTTGATAATCTCTCC

PyrGFow

TGCCTCAGCATTGGTACTTG

PyrGRev

GTACACTGGCCATGCTATCG

Ghi chú: phần gạch chân thể hiện đoạn trình tự ở 2 đầu của gen marker pyrG phục vụ cho phản ứng PCR hỗn hợp.

    1. Thiết kế khung biến nạp đặc hiệu

Marker chọn lọc được sử dụng trong nghiên cứu này là pyrG. Để gắn gen marker với 2 vùng trước và sau gen đích một cách nhanh chóng, chúng tôi sử dụng phương pháp PCR hỗn hợp (fusion PCR) [14]. Hai đoạn trước và sau gen translin có kích thước 1 kb lần lượt được khuếch đại từ ADN hệ gen tách chiết từ dòng R7B bằng các cặp mồi F189ups/ R189-pyrG và F189-pyrG/ R189dow. Gen marker pyrG được khuếch đại dựa trên khuôn là plasmid pEMP1 bằng cặp mồi PyrGFow/ PyrGRev. Sau đó 3 đoạn này được tiến hành PCR hỗn hợp sử dụng cặp mồi F189/R189.

Kết quả thu được 1 đoạn ADN kích thước khoảng 4 kb (Hình 3). Đoạn ADN này được tinh sạch và nhân dòng trong vector pGEM-T easy sử dụng kỹ thuật TA cloning. Plasmid tái tổ hợp pMAT769 có kích thước 7 kb được chọn lọc và kiểm tra bằng cách giải trình tự. Khung biến nạp gồm vùng trước và sau gen đích bao quanh gen marker pyrG được cắt ra từ pMAT769 bằng enzyme PvuII, sau đó khuếch đại bằng PCR sử dụng cặp mồi F189/R189 để tạo một lượng lớn ADN, chuẩn bị cho việc biến nạp tạo thể đột biến loại bỏ gen translin, phục vụ cho các phân tích chức năng của gen này ở nấm M. circinelloides.



Kết luận

N


Hình 3. Sản phẩm PCR hỗn hợp. 1: đoạn ADN hỗn hợp có kích thước 4 kb được tạo thành từ 3 đoạn ADN khác nhau. M: thang ADN chuẩn 1 kb
ghiên cứu đã xác định được một gen translin (ID 189520) ở nấm M. circinelloides có kích thước 1089 bp, gồm 6 exon và 5 intron. Gen này mã hóa một protein chứa 240 aa, có chứa một domain Translin. Gen mục tiêu đã được sử dụng để thiết kế các đoạn mồi đặc hiệu. Khung biến nạp đặc hiệu được thiết kế và nhân dòng bao gồm 2 vùng trước và sau gen đích bao quanh gen marker. Khung biến nạp này sẽ được sử dụng để loại bỏ gen translin ra khỏi hệ gen của M. circinelloides.

Lời cảm ơn

Nghiên cứu được thực hiện bằng nguồn kinh phí từ các dự án MICINN Tây Ban Nha (BFU2009-07220), MINECO (BFU2012-32246) tài trợ bởi FEDER và Quỹ học bổng Erasmus Mundus (action 2).



Tài liệu tham khảo

1 R. B. Billmyre, S. Calo, M. Feretzaki, X. Wang, and J. Heitman (2013). Rnai Function, Diversity, and Loss in the Fungal Kingdom. Chromosome Res, 21, 561-72.

2 J. P. de Haro, S. Calo, M. Cervantes, F. E. Nicolas, S. Torres-Martinez, and R. M. Ruiz-Vazquez (2009). A Single Dicer Gene Is Required for Efficient Gene Silencing Associated with Two Classes of Small Antisense Rnas in Mucor circinelloides. Eukaryot Cell, 8, 1486-97.

3 A. Fire, S. Xu, M. K. Montgomery, S. A. Kostas, S. E. Driver, and C. C. Mello (1998). Potent and Specific Genetic Interference by Double-Stranded Rna in Caenorhabditis Elegans. Nature, 391, 806-11.

4 A. Gutierrez, S. Lopez-Garcia, and V. Garre (2011). High Reliability Transformation of the Basal Fungus Mucor Circinelloides by Electroporation. J Microbiol Methods, 84, 442-6.

5 L. Li, S. S. Chang, and Y. Liu (2010). Rna Interference Pathways in Filamentous Fungi. Cell Mol Life Sci, 67, 3849-63.

6 L. Li, W. Gu, C. Liang, Q. Liu, C. C. Mello, and Y. Liu (2012). The Translin-Trax Complex (C3po) Is a Ribonuclease in Trna Processing. Nat Struct Mol Biol, 19, 824-30.

7 Y. Liu, X. Ye, F. Jiang, C. Liang, D. Chen, J. Peng, L. N. Kinch, N. V. Grishin, and Q. Liu (2009). C3PO, an Endoribonuclease That Promotes Rnai by Facilitating Risc Activation. Science, 325, 750-3.

8 C. Napoli, C. Lemieux, and R. Jorgensen (1990). Introduction of a Chimeric Chalcone Synthase Gene into Petunia Results in Reversible Co-Suppression of Homologous Genes in Trans. Plant Cell, 2, 279-89.

9 F. E. Nicolas, J. P. de Haro, S. Torres-Martinez, and R. M. Ruiz-Vazquez (2007). Mutants Defective in a Mucor Circinelloides Dicer-Like Gene Are Not Compromised in Sirna Silencing but Display Developmental Defects. Fungal Genet Biol, 44, 504-16.

10 F. E. Nicolas, S. Moxon, J. P. de Haro, S. Calo, I. V. Grigoriev, S. Torres-Martinez, V. Moulton, R. M. Ruiz-Vazquez, and T. Dalmay (2010). Endogenous Short Rnas Generated by Dicer 2 and Rna-Dependent Rna Polymerase 1 Regulate Mrnas in the Basal Fungus Mucor Circinelloides. Nucleic Acids Res, 38, 5535-41.

11 F. E. Nicolas, S. Torres-Martinez, and R. M. Ruiz-Vazquez (2003). Two Classes of Small Antisense Rnas in Fungal Rna Silencing Triggered by Non-Integrative Transgenes. EMBO J, 22, 3983-91.

12 N. Romano, and G. Macino (1992). Quelling: Transient Inactivation of Gene Expression in Neurospora Crassa by Transformation with Homologous Sequences. Mol Microbiol, 6, 3343-53.

13 Joseph Sambrook, David W. Russell, and Joseph Sambrook (2006). The Condensed Protocols from Molecular Cloning : A Laboratory Manual. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press, pp. v, 800 p.

14 M. Spiliotis (2012). Inverse Fusion Pcr Cloning. PLoS One, 7, e35407.

15 T. A. Trieu, S. Calo, F. E. Nicolas, A. Vila, S. Moxon, T. Dalmay, S. Torres-Martinez, V. Garre, and R. M. Ruiz-Vazquez (2015) A Non-Canonical Rna Silencing Pathway Promotes Mrna Degradation in Basal Fungi', PLoS Genet, 11, e1005168.



Identification and construction of gene replacement fragments to disrupt translin gene in Mucor circinelloides

Trieu Anh Trung1* and Francisco E. Nicolás2



1Faculty of Biology, Hanoi National University of Education; 2Faculty of Biology, University of Murcia, Spain

* Corresponding author, email: trungta@hnue.edu.vn



Abstract. RNA interference is a conserved gene regulatory mechanism in eukaryotes that represses gene expression in a homology-dependent manner. The canonical silencing mechanism requires the presence of the Dicer to process double-stranded RNA (dsRNA) precursors into small interfering RNAs (siRNAs) about 20-25 nt, which guide the RNA-induced silencing complex (RISC) to degrade target mRNAs. In the basal fungus Mucor circinelloides, the studies have indicated that there are at least two RNAi mechanisms with or without Dicer. Translin gene was demonstrated that involves in RNAi by removing siRNA passenger strand in animals. This study was performed to identify Translin coding gene and construct a gene replacement fragment to obtain knock-out mutant for this gene in M. circinelloides. These mutant strains will be used for functional analyses of Translin protein in Mucor.

Keywords: RNA interference (RNAi), small RNA, Mucor circinelloides, Translin




: app -> webroot -> files -> hoithao
hoithao -> Kandelia obovata Sheue, Liu & Yong
hoithao -> Đánh giá khả năng phòng trừ tuyến trùng (Meloidogyne spp.) của dịch chiết từ cây mầm súp lơ xanh
hoithao -> KẾt quả ĐIỀu tra bưỚC ĐẦu về nguồn lợi cá VÙng ven biển huyện cẩm xuyêN, TỈnh hà TĨNH
hoithao -> Chi trâm hoàng – kayea wall. (HỌ BỨA – clusiaceae lindl.) Ở việt nam
hoithao -> Nguyễn Đăng Hội1, Kuznetsov A. N. 1, Kuznetsova S. P. 1, Lê Thị Nguyệt2
hoithao -> Vũ Văn Liên Bảo tàng Thiên nhiên Việt Nam, vast
hoithao -> Nghiên cứU Ảnh hưỞng của chế phẩm VI sinh và phân hữu cơ VI sinh đẾn một số chỉ tiêu sinh lí – HÓa sinh và SỰ TÍch lũy kim loại chì (Pb) CỦa câY ĐẬu bắP
hoithao -> PHÂn tích tính đa dạng và thành lập bảN ĐỒ thảm thực vật khu vực trạM Đa dạng sinh học mê linh, VĨnh phúC
hoithao -> Genus pycnarrhena miers ex Hook f. & Thomson,
hoithao -> KHẲng đỊnh chi cosmianthemum và loài cosmianthemum knoxiifolium (C. B. Clarke) B. Hansen thuộc họ Ô RÔ (acanthaceae) CÓ phân bố Ở việt nam




Cơ sở dữ liệu được bảo vệ bởi bản quyền ©hocday.com 2019
được sử dụng cho việc quản lý

    Quê hương