1. MỞ ĐẦu tính cấp thiết của đề tài



tải về 196.89 Kb.
trang1/2
Chuyển đổi dữ liệu21.08.2016
Kích196.89 Kb.
  1   2
KẾT QUẢ NGHIÊN CỨU CHỌN GIỐNG BÔNG CHỐNG BỆNH XANH LÙN NĂM 2007

Chủ trì đề tài: KS. Trịnh Minh Hợp

Thực hiện: Nguyễn Thị Nhã, Nguyễn Thị Dung,

Nguyễn Thị Thuật

1. MỞ ĐẦU

1.1. Tính cấp thiết của đề tài

Bệnh xanh lùn bông (blue disease hoặc leaf roll), lần đầu tiên được mô tả ở Cộng Hòa Trung Phi năm 1949, sau đó, bệnh xuất hiện và gây hại ở nhiều nước thuộc Châu Phi, Châu Á và Châu Mỹ (Cauqil J, 1977). Khi cây bông bị bệnh nặng, đốt thân và cành ngắn lại, có dạng zic-zăc, không hoá gỗ được, cây lùn, có khi nằm bò ra; nụ, hoa, quả giảm; chất lượng xơ kém; và năng suất có thể giảm 30-100% (Hillocks, 1992). Ở Việt Nam, bệnh được phát hiện vào năm 1985 tại Ninh Thuận (Nguyễn Thị Thanh Bình, 1999), sau đó, bệnh xuất hiện và gây hại nghiêm trọng ở hầu hết các vùng bông trọng điểm trong cả nước và đang là trở ngại chính cho tăng năng suất và mở rộng diện tích bông.

Hiện nay, để tạo giống kháng bệnh vi rút, người ta tiến hành theo hai hướng. Hướng thứ nhất là tìm nguồn gen kháng trên thực vật, tuy nhiên, hướng này ít hiệu quả, vì có rất ít gen kháng bệnh vi rút tồn tại trên thực vật. Hướng thứ hai được quan tâm nhiều hơn và đã đạt được nhiều thành tựu là tách dòng gen mã hóa protein vỏ và định loại vi rút gây bệnh, sau đó biểu hiện và thiết kế dòng gen này vào các vec tơ chuyển gen để chuyển cho thực vật. Cơ sở khoa học của hướng nghiên cứu này là thực vật có khả năng kháng lại các chủng vi rút gây bệnh nếu trước đó nó được gây nhiễm hay biến nạp đoạn ADN mã hóa protein vỏ của loại vi rút này. Theo hướng này, đã có nhiều giống cây trồng kháng bệnh vi rút được tạo ra như đu đủ (bệnh vi rút đốm vòng), khoai tây, cà chua, dưa chuột (bệnh nhăn lá), bông (bệnh xoăn lá) …

Theo các nghiên cứu trên thế giới, tác nhân gây bệnh xanh lùn bông là do vi rút CLRDV (cotton leafroll dwarf virus). Bằng chứng về huyết thanh học cho thấy, vi rút này có quan hệ rất gần với một số loài trong họ Luteoviridae, còn theo bằng chứng về phân tử thì nó là thành viên của chi Polerovirus họ Luteoviridae (R.L. Corrêa và cs., 2005). Cũng giống như các thành viên khác của Luteoviridae, CLRDV lan truyền bằng rệp bông (Aphis gossypii) theo phương thức bền vững (Cauquil J, 1977, 1983; Hillocks, 1992; Nguyễn Thị Thanh Bình, 1999).

Ở Việt Nam, vấn đề tạo giống kháng bệnh xanh lùn đã được đặt ra từ lâu, tuy nhiên đến nay, vẫn chưa tìm được nguồn gen kháng trên cây bông và chưa có bằng chứng tin cậy về phân tử của vi rút bệnh xanh lùn. Trên cơ sở tương đồng về triệu chứng gây bệnh, phương thức truyền bệnh với vi rút CLRDV, chúng tôi đã sử dụng các cặp mồi đặc hiệu thiết kế từ trình tự đặc trưng của chi Polerovirus để nghiên cứu xác định nguyên nhân gây bệnh xanh lùn của Việt Nam làm tiền đề cho công tác tạo giống bông kháng bệnh xanh lùn. Đây cũng chính là nội dung nghiên cứu của đề tài chọn giống chống bệnh xanh lùn trong năm 2007

1.2. Mục tiêu của đề tài

- Tách dòng gen mã hóa protein vỏ của vi rút gây bệnh xanh lùn;

- Tạo giống chống được bệnh xanh lùn bông.

1.3. Nội dung nghiên cứu trong năm 2007

1- Tách chiết và tinh sạch ADN và ARN tổng số từ mô lá bông bị bệnh xanh lùn và mô lá của cây ký chủ của vi rút gây bệnh xanh lùn.

2- Thực hiện các phản ứng PCR và Reverse-PCR giữa ADN và ARN tổng số với các cặp mồi đặc hiệu (được thiết kế dựa trênh tự ADN và ARN bộ genom của các loài vi rút dự đoán là nguyên nhân gây bệnh xanh lùn) để nhân các đoạn ADN và cADN mã hoá cho protein vỏ của vi rút.

3- Tách dòng các đoạn ADN và cDNA thu được vào các vectơ tách dòng thích hợp, giải trình tự các đoạn ADN và cDNA đó.

4- So sánh và phân tích các trình tự ADN và ARN gen để định loại vi rút gây bệnh.

2. TỔNG QUAN TÀI LIỆU

2.1. Tình hình nghiên cứu ngoài nước

2.1.1. Sơ lược về bệnh xanh lùn bông

Trên thế giới, có khoảng 20 bệnh vi rút trên bông (Tarr, S.A.J., 1964; Watkins, G.M., 1981; Hillocks, 1992), chúng gây thiệt hại nghiêm trọng ở các vùng trồng bông của các nước thuộc khu vực có khí hậu bán nhiệt đới và nhiệt đới ở Châu Phi, Châu Á, Trung và Nam Mỹ. Tác nhân gây bệnh hầu như chưa được phân lập và mô tả, vì vậy, nguyên nhân gây ra những bệnh này có thể là cùng loại hay khác loại... là câu hỏi lớn cho các nhà khoa học bệnh cây. Bệnh vi rút bông có thể được chia thành các nhóm dựa vào triệu chứng và vectơ truyền bệnh. Hillocks (1992) đã phân các bệnh vi rút bông thành 6 nhóm, bao gồm bệnh khảm lá bông châu Phi (African cotton mosaic), bệnh hóa đỏ lá bông (cotton anthocyanosis disease), bệnh xanh lá và cuốn lá bông (cotton blue disease hay leaf roll disease), bệnh nhăn lá bông (cotton leaf crumple disease), bệnh xoăn lá bông châu Phi (African cotton leaf curl), bệnh biến vàng gân lá bông (cotton yellow vein).

Tất cả các bệnh vi rút bông đều lan truyền trong tự nhiên qua môi giới là côn trùng theo phương thức bền vững, trong đó, chỉ có nhóm bệnh xanh lá-cuốn lá và bệnh hóa đỏ lá bông do rệp bông (Aphis gossypii) truyền, 4 nhóm bệnh còn lại đều do bọ phấn trắng (Bemisia tabaci) truyền. Hầu như chưa có kết quả nghiên cứu rõ ràng về nguyên nhân gây bệnh. Riêng 2 bệnh là nhăn lá (leaf crumple) và xoăn lá (leaf curl) được xác định chính xác là do vi rút gây ra, tác nhân gây bệnh đó được nhận dạng và định loại là vi rút thuộc họ Geminiviridae. Hệ gen của chúng gồm 2 phân tử sợi đơn mạch vòng (ADN-A và ADN-B), hoặc thường gặp hơn là dạng sợi đơn mạch vòng (ADN-A), mỗi phân tử chứa khoảng 2.600-2.800 nucleotit. Trong các nhóm trên, bệnh xanh lùn (hay bệnh xanh và cuốn lá bông) xuất hiện khá sớm và gây hại nghiêm trọng. Bệnh do rệp bông (Aphis gossypii Glover) lan truyền (Cauquil, J., 1971). Nhóm bệnh này xuất hiện ở đầu tiên Cộng hoà Trung Phi vào năm 1949 (Tarr, 1964), sau đó, nó có mặt ở các nước lân cận, như tại Chad, Cameroon, Benin, Zaire và Ivory Coast. Tại châu Á, bệnh cuốn lá được phát hiện ở Azerbaigian, Turmenistan, Tadgikistan và Armenia. Ở Thái Lan, bệnh cuốn lá được phát hiện năm từ năm 1963. Tại một số nước như Philippin, Indonesia cũng có triệu chứng bệnh tương tự xuất hiện. Triệu chứng đầu tiên xuất hiện trên những lá non trên ngọn, lá phồng lên, rìa lá cong nhẹ về phía dưới, những vùng thịt lá ở giữa các gân chính có màu xanh sáng, khi lá già thì toàn bộ lá cong xuống rất nhiều, cấu trúc giòn, có mầu xanh sẫm đồng nhất, vì thế, người ta gọi là bệnh xanh lá. Cây nhiễm bệnh sớm thì đốt thân và cành ngắn lại và có dạng zic-zăc, không hoá gỗ được, cây lùn, có khi nằm bò ra, nụ, hoa, quả giảm về số lượng và kích thước.

Bệnh xanh lùn bông có biểu hiện triệu chứng tương tự bệnh cuốn lá xuất hiện ở Brazil năm 1964 (Costa, 1996) Paraguay, Bolivia và ở Argentina. Rệp bông (Aphis gossipii Glover) là vectơ truyền bệnh (Bonacic, I., 1997). Bằng phương pháp huyết thanh học, họ kết luận vi rút này có quan hệ rất gần với các loài thuộc họ Luteoviridae (Bonacic, I., 1997), cụ thể hơn là kết quả ELISA dương tính yếu với kháng thể của BWYV (Beet western yellow virus) (R.L. Corrêa và cs., 2005), đây là thành viên của Polerovirus-Luteoviridae. Bằng kỹ thuật hiển vi điện tử, R.L. Corrêa và cs (2005) đã tinh sạch được vi rút này, nó có kích thước xấp xỷ 30nm (ảnh 2). Dùng phương pháp RT-PCR với các cặp mồi đặc hiệu của các chi Luteovirus Polerovirus, họ đã nhân được 1 đoạn ADN có kích thước 1.058 nt, được xác định là tương đồng với trình tự ORF2 và 3 của chi Polerovirus. Phân tích trình tự 201 amino axít của CP gen cho thấy, CP của CLRDV tương đồng 92% với CP của CpSDaV-một loài trong Luteoviridae. CP-CLRDV tương đồng với các thành viên khác của Polerovirus như TYV (79%), BMYV (78%), BChV (78%) và BWYV (77%). Bên cạnh đó, khi phân tích RdRp, người ta thấy rằng, trình tự này tương đồng cao với các loài trong Polerovirus hơn Luteovirus. Phân tích hệ thống theo sơ đồ hình cây thấy rằng, cả gen CP và RdRp đều có quan hệ gần với Polerovirus hơn Luteovirus (R.L. Corrêa và cs., 2005). Họ cũng phát hiện ra vùng xen giữa CP và RdRp có trình tự 187 nucleotit, kết quả này cũng phù hợp với cấu trúc vùng xen giữa (khoảng 200 nt) của Polerovirus (D’ Arcy và cs., 2000).



2.1.2. Sơ lược về nghiên cứu genom họ Luteoviridae

Phụ thuộc vào cấu trúc genom, sự tương đồng trình tự và phương thức biểu hiện gen mà họ Luteoviridae được chia làm 3 chi là Luteovirus, Polerovirus Enamovius (D’ Arcy và cs., 2000). Genom của vi rút họ này trung bình dài 5.700 nucleotid (Mayo và Ziegler-Graff, 1996). Đường kính vi rút khoảng 25nm, protein vỏ tương đương 180 tiểu phần có 2 vùng chính là vùng R và S. Cấu trúc không gian 3 chiều gồm hai dạng bậc 2 và bậc 3 (Dolja và Koonin, 1991; Mayo và Ziegler-Graff, 1996; Terradot và cs., 2001; Brault và cs., 2003; Lee và cs., 2005). Đây là nhóm vi rút thực vật quan trọng (Harrison, 1999).

Cấu trúc genom của họ Luteoviridae là ssRNA chứa 6 khung đọc mở (ORF) từ ORF0 đến ORF6. Trong đó, ORF0 chỉ có ở chi Polerovius Enamovirus mã hóa một protein không rõ chức năng. ORF1 và 2 mã hóa protein liên quan đến sự tái bản của vi rút. Ở cả 3 chi, ORF2 được biểu hiện thông qua việc dịch mã framshif ở ORF1. Trong đó, ORF1 đè lên ORF2 khoảng 20 nt ở Luteovirus và khoảng 400nt ở Enamo-Polerovirus. Vùng xen giữa ORF2 và 3 có khoảng 100nt ở Luteovirus và 200 nt ở Polero-enamovirus. ORF3 và 5 mã hóa protein vỏ (CP) và protein RT (readthrough) của vi rút. ORF4 mã hóa protein di chuyển (MP) của vi rút và nó không có ở Enamovirus.

So sánh tương đồng giữa các loài trong họ Luteoviridae với nhau, người ta thấy rằng, ARN tái tổ hợp đóng vai trò quan trọng trong việc phát sinh loài mới trong họ (Miller và cs., 1995). Việc tái tổ hợp thường xảy ra tại vị trí mở đầu trong quá trình tổng hợp gen phụ ARN (sgRNA)-mã hóa protein vỏ và protein di chuyển. Như vậy, Luteoviridae chứa các loài có cấu trúc protein tương đồng nhưng những gen RdRp lại khác hẳn nhau. Ví dụ như, Cucurbit aphid-borne yellows virus (CABYV) có nguồn gốc từ việc tái tổ hợp giữa PoleroEnamovirus (Gibbs và cs., 2000). Tương tự như vậy, Sugarcane yellow leaf virus (ScYLV) là vi rút tái tổ hợp của chi LuteoPolerovirus, nó có CP-luteovirus nhưng RdRp-polerovirus (Smith và cs., 2000), ngược lại, Soybean dwarf virus (SbDV) được tái tổ hợp từ PoleroLuteovirus (Rathjen và cs., 1994; Terauchi và cs., 2001), vi rút này có gen CP thuộc Polerovirus nhưng gen polymease lại thuộc Luteovirus. Tổng kết lại cho thấy, đặc trưng của 3 chi trong Luteoviridae là gen RdRp và dùng gen này để định loại vi rút, còn việc dùng đơn lẻ gen CP thì hiệu quả cao trong phân loại sẽ không tối ưu (Lélie L. và cs., 2002).



2.2. Tình hình nghiên cứu trong nước

Xanh lùn là bệnh gây hại quan trọng nhất cho cây bông ở Việt Nam hiện nay. Bệnh được phát hiện lần đầu tiên tại Nha Hố (Ninh Thuận) trong những năm 1984-1985 nhưng chưa gây hại đáng kể, sau đó, tác hại của bệnh tăng dần. Dịch bệnh đầu tiên xảy ra tại Ninh Thuận năm 1991, sau đó dịch xảy ra liên tiếp ở hầu hết các vùng trồng bông trọng điểm.

Tại Việt Nam, nghiên cứu bệnh xanh lùn bắt đầu từ năm 1985. Kết quả cho thấy, triệu chứng bệnh xanh lùn bông ở Việt Nam tương tự như triệu chứng của nhóm bệnh xanh lá và cuốn lá ở châu Phi, Nam Mỹ và Thái Lan. Con đường lan truyền của bệnh trong tự nhiên nhờ côn trùng môi giới là rệp bông (Aphis gossypii) theo phương thức bền vững, truyền nhân tạo qua ghép cây, không truyền qua rầy xanh, bọ trĩ, đất, hạt giống, dịch cây, phấn hoa, không truyền từ rệp mẹ mang vi rút sang đời con (Nguyễn Thị Thanh Bình, 1999).

Nghiên cứu về xác định nguyên nhân gây bệnh ở mức độ phân tử và tách dòng gen mã hóa protein vỏ của vi rút đã được đặt ra và tiến hành từ năm 2004. Lúc đầu, với giả thuyết cho rằng, vật liệu di truyền của vi rút là ADN, Lê Quang Huấn và cs (2004) đã sử dụng cặp mồi nhân vi rút gây bệnh nhăn lá bông và dùng ADN tổng số của lá bông bị bệnh và của rệp thu trên cây bông bị bệnh làm khuôn. Kết quả đã tách được một gen có kích thước 637 nt, tuy nhiên, khi so sánh tương đồng trình tự đã không xác định được đoạn gen này thuộc nhóm vi rút nào. Đến năm 2005 và 2006, sau khi R.L. Corrêa và cs công bố trình tự gen CP của CLRDV, chúng tôi tiến hành thiết kế cặp mồi dựa vào trình tự này để nhân gen trong ARN tổng số tách chiết từ lá bông bị bệnh ở Việt Nam, kết quả là cũng nhân được một đoạn gen có trình tự 686 nt, nhưng khi so sánh trình tự cũng chưa xác định loại được vi rút gây bệnh (Đặng Minh Tâm và cs, 2006).



2.3. Một số kỹ thuật sử dụng trong đề tài

2.3.1. Kỹ thuật PCR và RT-PCR


Kỹ thuật PCR (Polymerase Chain Reaction-Phản ứng dây chuyền nhờ polymerase) do Kary Mullis và cộng sự phát minh vào năm 1983 đã góp phần tạo ra cuộc cách mạng sinh học phân tử. Kỹ thuật PCR là phương pháp hoàn toàn mới trong việc nghiên cứu và phân tích gen. Sử dụng kỹ thuật này có thể tạo ra một số lượng lớn các bản sao của đoạn ADN mà không phải tách dòng, nhân dòng hay sử dụng các sinh vật sống như E.coli hoặc nấm men. Sau khi hoàn thiện và công bố năm 1985, phương pháp PCR đã được ứng dụng rộng khắp trên nhiều lĩnh vực, cả trong khoa học công nghệ và đời sống xã hội.

Hiện nay, kỹ thuật PCR giúp hữu ích cho việc xác định trình tự của các đoạn ADN được nhân, giúp phát hiện đột biến, cho phép phân tích liên kết gen từ những tế bào riêng lẻ và thậm chí có thể giúp nghiên cứu tiến hóa ở mức độ phân tử… Xét nghiệm PCR cho chúng ta biết sự hiện diện của gen mục tiêu. Phương pháp này đủ nhạy để tìm ra lượng ADN ít ỏi trong mọi loại mẫu. Nó được sử dụng để tách dòng các đoạn ADN từ các xác ướp và những sinh vật tuyệt chủng, qua đó một ngành mới xuất hiện đó là khảo cổ học phân tử và cổ sinh vật học phân tử. Ngoài lợi ích đối với việc tách dòng ADN, nó còn là công cụ hữu hiệu trong pháp y. Nó cũng được sử dụng để chuẩn đoán vi rút trước khi chúng gây lên các triệu chứng hay gây ra đáp ứng miễn dịch trông thấy hoặc phát hiện các bệnh di truyền trước khi sinh (Rose E.A., 1991).

Kỹ thuật RT-PCR là sự kết hợp của hai phản ứng sao mã ngược (reverse transcription-sơ đồ 1) và PCR để nhân lên một đoạn gen quan tâm từ ARN tổng số trong đó chứa mARN. Do tích chất của mARN của tế bào eukaryota bao giờ cũng gắn thêm một đoạn đuôi polyA nên trong điều kiện invitro với sợi khuôn là mARN có trong ARN tổng số, nếu ta sử dụng một đoạn mồi oligo(dT) khoảng 12-18 bazơ thì đoạn mồi này sẽ bắt cặp bổ sung với đuôi polyA của mARN. Khi có mặt enzym sao mã ngược và các dNTP tự do, ở nhiệt độ 42oC trong 1 giờ, đoạn mồi này sẽ được kéo dài tạo thành các sợi cDNA (ADN bổ sung) bổ sung với mARN. Như vậy, sợi đơn cDNA thứ nhất đã được tổng hợp. Để tăng cường hiệu quả của quá trình tổng hợp, lượng oligodT được cho vào lớn hơn rất nhiều so với lượng mRNA và chất kìm hãm RNaza cũng được đưa vào để bảo vệ cho RNA khỏi bị phân hủy. Sau khi sợi cDNA thứ nhất được tổng hợp thì kỹ thuật PCR được áp dụng để nhân gen quan tâm với các cặp mồi đặc hiệu cho gen đó.

2.3.2. Kỹ thuật nhân bản vô tính (cloning)

Đây là quá trình gắn các đoạn ADN vào các vectơ thích hợp nhờ enziym T4 ligaza xúc tác cho quá trình hình thành liên kết nối 2 đoạn ADN. Đoạn ADN sau khi được nhân lên được đưa vào vectơ nhân dòng phù hợp, ví dụ vectơ pCR2.1 (sơ đồ 2). vectơ tái tổ hợp này sẽ được chuyển vào tế bào chủ (E.coli), ở đây các đoạn ADN sẽ được nhân lên thành nhiều bản sao giống y hệt nhau (gọi là clone-dòng vô tính- quần thể tế bào đồng nhất về mặt di truyền). Những dòng này sẽ được phân tích và xác định rõ trình tự và những đặc tính cần thiết.

Vectơ nhân dòng pCR2.1(TA-cloning) được thiết kế riêng cho việc nhân dòng và xác định trình tự nucleotit của một dòng gen nào đó. Do tính chất của sản phẩm PCR khi sử dụng enzym Taq polymerase để nhân một đoạn gen thì bao giờ trên mỗi mạch đơn hai đầu sản phẩm cũng gắn thêm một dATP vào nên vectơ pCR2.1 được thiết kế dạng mở và trên mỗi mạch đơn ở hai đầu có gắn thêm một dATP. Vì vậy, ADN sản phẩm của phản ứng PCR có thể gắn trực tiếp vào vectơ này nhờ enzym T4 ligase. Xung quanh điểm cài đoạn ADN này có vị trí nhận biết của một số enzym hạn chế để dễ dàng cho việc thiết kế cấu trúc gen sau này. Phía trái của điểm cài đoạn ADN là đoạn promotor cần cho việc biểu hiện của gen lacZα, trùm qua điểm cài đoạn gen lacZα mã hoá cho 146 axít amin của β-galactosidase giúp cho việc chọn lọc khuẩn lạc xanh/trắng. Vectơ này mang vùng gen tự sao mã ColEl origin biểu hiện số lượng cao bản sao trong E. Coli và gen chọn lọc là hai gen kháng kanamycin và ampicilin. Đặc biệt có trình tự bắt cặp bổ sung của hai đoạn mồi M13F và M13R nằm gần hai điểm chèn phục vụ cho việc xác định trình tự đoạn ADN được chèn vào.

3. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU

3.1. Vật liệu nghiên cứu

3.1.1. Mẫu lá sử dụng để tách chiết ARN tổng số

- Lây nhiễm và lấy mẫu lá trên 2 giống bông VN15 và D97-5.

- Mẫu lá 2 giống bông VN15 và D97-5 không bị bệnh xanh lùn được thu từ lá non mới nhú của cây không bệnh trồng trong nhà kính, đảm bảo sạch bệnh hoàn toàn; mẫu lá bị bệnh tự nhiên được thu từ cây bị bệnh xanh lùn ngoài đồng; mẫu lá bị bệnh nhân tạo được thu từ cây nhiễm bệnh nhân tạo trong nhà kính.

- Mẫu lá cây chổi đực sạch bệnh và mang mầm bệnh.



3.1.2. Mồi

Sử dụng 3 cặp mồi suy biến được thiết kế từ trình tự đặc trưng đại diện các ORF (khung đọc mở) của chi Polerovirus theo R.L. Corrêa và cs., 2005: PL, PL2 (nhân gen RdRp: RNA lệ thuộc RNA polymerase) và PL4F-o3R (nhân gen CP).

PLF (5ACDGAYTGYTCYGGTTTYGACTGG 3’)

PLR (5TCTGAWARASWCGGCCCGAASGTGA 3’)

PL2F (5AACAATTAGGTTTTAAAGTCGAGG 3’)

PL2R (5TTCTACCCACGACCGTATTCAT 3’)

PL4F (5TGCGACAAATAGT TAATGAATACGGT 3’)

O3R (5GTCTACCTATTTBGGRTTNTGGAA 3’)



3.1.3. Các trình tự dùng để so sánh tương đồng

Bảng 1. Các trình tự thuộc họ Luteoviridae được lấy từ GenBank database

TT

Tên viết tắt

Loài

Mã số

Enamovirus

1

PEMV-SP

Pea enation mosaic virus-SP

AF082833

Luteovirus

1

BYDV

Barley yellow dwarf virus

NC004666

2

BLRV

Bean leafroll virus

NC003369

3

GRAV

Groundnut rosette assistor virus

AF195827

4

SbDV

Soybean dwarf virus-YS

NC003056

Polerovirus

1

BChV

Beet chlorosis virus

NC002766

2

BMYV

Beet mild yellowing virus

NC003491

3

BWYV

Beet western yellows virus

NC004756

4

CYDV

Cereal yellow dwarf virus

NC002198

5

CLRDV

Cotton leafroll dwarf virus

AY758560

6

CLRDV

Cotton leafroll dwarf virus

AY758561

7

CpSDaV

Chickpea stunt disease associated virus

Y11530

8

CABYV

Cucurbit aphid-borne yellows virus

NC003688

9

PLRV

Potato leafroll virus

AF022782

10

TVDV

Tobacco vein distorting polerovirus

AF402621

11

TYV

Turnip yellows virus

NC003743

12

ScYLV

Sugarcane yellow leaf virus

NC000874

3.1.4. Hóa chất và dụng cụ (xem phụ lục 1)

3.2. Phương pháp nghiên cứu

3.2.1 Truyền bệnh xanh lùn nhân tạo

Ở giai đoạn cây con (7-10 ngày sau gieo), truyền lần 1 bằng rệp trên cây bị bệnh (15-25 con/cây), sau 48 giờ, phun thuốc diệt rệp; ở giai đoạn 30-50 ngày sau gieo, truyền lần 2 cho các cây chưa bị bệnh bằng cách ghép áp với cây bệnh.



3.2.2. Tách chiết ADN và ARN tổng số từ lá bông và lá chổi đực

- Tách chiết ADN tổng số theo quy trình của Li và cs, 2001 (phụ lục 2).

- Tách chiết ARN tổng số theo quy trình (phụ lục 3). Toàn bộ các dung dịch sử dụng, ngoại trừ Tris-HCl, được chuẩn bị bằng nước khử ion đã xử lý diethylpyrocarbonate (DEPC) (Sambrook và cs., 1989), sau đó được hấp vô trùng.

- Phân tích ADN tổng số trên gel agarose 0,8%, phân tích kết quả PCR trên gel agarose 1,2%. Nhuộm gel bằng EtBr 0,5g/ml trong 15 phút, rửa sạch bằng nước, soi gel trên đèn UV, chụp ảnh và phân tích kết quả.

- ARN được phân tích (phụ lục 3.3) trên gel agarose 1%, chứa 2,2M formaldehyde, có sự hiện diện của ethidium bromide (Maniatis và cs., 1982). ARN có chất lượng tốt được đánh giá bằng sự hiện diện của các băng rARN.

3.2.2. Nhân dòng cADN và đọc trình tự

- Phản ứng sao mã ngược-RT (reverse transcription) tổng hợp cADN được thực hiện trên máy PCR iCycler trong 2 giờ ở 45 C.

- Phản ứng PCR với thể tích phản ứng 25l, trong đó chứa các thành phần phản ứng là H2O, 1X PCR buffer, 2,5mM MgCl2, 100M dNTPs, 25pM mồi/1 mồi, 3µl sản phẩm cADN và 0,5-1U Taq DNA polymerase. Chu kỳ nhiệt cho phản ứng PCR xác định sự hiện diện của gen quan tâm: (1) 950C trong 3 phút, (2) 940C trong 30 giây, (3) 45-550C (cho mồi PLF, PLR, PL2F, PL2R) hoặc 42-500C (cho mồi PL4F, o3R) (4) 720C trong 1 phút, (5) lặp lại (từ bước 2 đến 4) 35 chu kỳ, (6) 720C trong 5 phút, (7) giữ lạnh ở 40C. Sản phẩm PCR được phân tích trên gel agarose 1,2%.

- Toàn bộ các phân đoạn sau khi nhân được nhân dòng trong vec tơ pCR 2.1 của Ivitrogen, 3 dòng/mẫu được đọc trình tự với M13 trên máy phân tích trình tự tự động.



3.2.3. Phân tích trình tự

Các trình tự amino a xít được phân tích tương đồng trên phần mềm trực tuyến Blast của NCBI và phần mềm Bio-Edit.



3.3. Các chỉ tiêu theo dõi

  1. Chất lượng ADN và ARN tổng số tách chiết;

  2. Kích thước các đoạn gen nhân được;

  3. Kết quả nhân dòng (a) kết quả biến nạp, (b) ADN plasmid và (c) cắt ADN plasmid tái tổ hợp;

  4. Kết quả so sánh trình tự;

  5. Kết quả định loại vi rút.

4. KẾT QUẢ VÀ THẢO LUẬN

4.1. Kết quả phân lập và tạo mẫu lá sạch và nhiễm bệnh xanh lùn

Việc phân lập và tạo mẫu bệnh phục vụ cho tách chiết và tinh sạch ADN, ARN tổng số là rất cần thiết. Sử dụng các phương pháp lây nhiễm bệnh nhân tạo vào cây bông và cây ký chủ của Nguyễn Thị Thanh Bình và cs (1999), kết hợp với thu mẫu ngoài đồng, chúng tôi đã có đủ số mẫu cần thiết, đáp ứng yêu cầu của nội dung nghiên cứu tiếp theo.



- Thu thập mẫu lá bông bị bệnh xanh lùn ngoài tự nhiên

Tiến hành điều tra tìm cây bông bị bệnh xanh lùn ở ngoài đồng, chọn những cây bị bệnh xanh lùn có triệu chứng rõ rệt, thu lá non.



- Tạo mẫu lá bông sạch bệnh và bệnh nhân tạo

Để tạo mẫu lá bông sạch bệnh, hạt bông của các giống được gieo vào khay, úp lồng, đặt trong nhà kính, đảm bảo không có rệp sinh sống trên cây. Khi cây mọc lên, thu lấy lá sò hoặc lá non mới nhú của những cây đã lớn.

Để tạo mẫu lá bị bệnh, hạt bông của các giống cũng được gieo vào khay, úp lồng, đặt trong nhà kính, đảm bảo không có rệp sinh sống trên cây. Khi cây bông có 3-4 lá thật, thu rệp ở trên bông bị bệnh xanh lùn thả lên các cây bông này, 15 ngày sau, cây bông bị bệnh xanh lùn, chọn thu các lá non trên cây có triệu chứng bệnh rõ rệt.

- Tạo mẫu lá cây chổi đực (cây ký chủ) sạch và mang mầm bệnh

Tạo mẫu lá cây chổi đực không mang mầm bệnh bằng cách gieo hạt cây chổi đực vào bầu nilon, úp lồng, đặt trong nhà kính, đảm bảo không có rệp sinh sống trên cây. Khi cây lớn lên, thu lấy lá non mới mọc.

Việc tạo mẫu lá cây chổi đực bị bệnh phức tạp hơn, đầu tiên, truyền rệp từ cây bông đã bị xanh lùn sang cây chổi đực, sau đó, thu rệp từ cây này truyền sang cây bông sạch bệnh có 3-4 lá thật khác và đánh số thứ tự tương ứng với cây ký chủ, sau 15 ngày, cây bông nào bị bệnh thì chứng tỏ cây chổi đực tương ứng mang mầm bệnh, cây chổi đực này sẽ được thu lá non.

Các mẫu lá sau khi thu được rửa sạch bằng cồn và nước cất, thấm khô lá, cho vào ống eppendoft 2ml và bảo quản ở điều kiện -800C.



4.2. Kết quả nghiên cứu tách chiết ADN và ARN tổng số

4.2.1 Nghiên cứu tách chiết ADN tổng số

Sử dụng quy trình tách chiết ADN tổng số của Li và cs, 2001 để tách chiết cho các loại mẫu lá nghiên cứu, kết quả kiểm tra trên điện di đồ cho thấy, ADN tổng số thu được cho một băng duy nhất, sắc nét, gần giếng. Chứng tỏ AND tách chiết có trọng lượng phân tử cao, không đứt gẫy và có độ sạch cao, đủ tiêu chuẩn cho kỹ thuật PCR.



4.2. 2. Nghiên cứu tách chiết ARN tổng số

* Kết tách chiết ARN tổng số

Trên thực vật, có một số phương pháp tách chiết ARN tổng số cho năng suất và chất lượng tốt từ hạt, rễ, lá và hoa, như phương pháp guanidium thiocya-nate-phenol-chloroform (Chomczinsky ADN Sacchi, 1987), TriZol reagent (Life Technologies), phương pháp guanidium chloride (Sambrook, 1989)… Tuy nhiên, đối với cây bông đặc biệt là cây bông bị bệnh xanh lùn và một số cây ký chủ của bệnh thì có rất ít nghiên cứu. Năm 2006, chúng tôi có sử dụng một số quy trình thông dụng để tách ARN tổng số cho các mẫu lá bông, tuy nhiên, kết quả thu được chưa đạt yêu cầu. Tiếp tục kinh nghiệm từ 2006, chúng tôi tập trung vào sử dụng 2 phương pháp tách theo kít sử dụng TriZol reagent (Invitrogen) và phương pháp chiết phenol. Kết quả cho thấy, cả 2 phương pháp đều tách chiết được ARN tổng số từ lá bông và lá cây chổi đực. Về bản chất, 2 phương pháp này là giống nhau vì cùng sử dụng phenol để loại bỏ ADN, protein và các hợp chất khác. Tuy nhiên tách chiết theo phương pháp chiết phenol mất nhiều công hơn (chuẩn bị các dung dịch nhiều, sử dụng nhiều loại hóa chất hơn, thao tác nhiều và cần tỷ mỉ hơn). Vì vậy, chúng tôi đề nghị tách chiết theo kít TriZol reagent của hãng Invitrogen.

So sánh các loại mẫu tách chiết cho thấy, với lá bông và mẫu sạch bệnh cho chất lượng RNA tốt nhất, mẫu bị bệnh nhân tạo và tự nhiên có chất lượng kém hơn. Nguyên nhân có thể là do những mẫu này già hơn nên có hàm lượng phenol và các hợp chất thứ cấp khác cao hơn, gây khó khăn cho việc tinh sạch. So với mẫu lá bông, thì mẫu lá chổi đực (cây ký chủ) khó tách chiết ARN hơn. Trong quá trình tách chiết ở mẫm này, đã bổ sung thêm 1 lần chiết với trizol mà kết quả thu được vẫn kém hơn.

* Kết quả điện di ARN tổng số

Thông thường ARN tổng số thực vật bao gồm 3 loại mARN, tARN và rARN. Trong đó, rARN chiếm 80-85%, tARN chiếm 15-20%, còn mARN chiếm 1-5%. Các ARN này có kích thước, trình tự xác định và có thể tách riêng bằng các kỹ thuật như điện di hay li tâm. Do đó, điện di đồ ARN ribosom là một trong những chỉ tiêu đánh giá chất lượng ARN tổng số. Bằng phương pháp điện di thông thường (sử dụng cho ADN) thì không biết được chất lượng ARN. Khi gel agarose chứa 2,2M formaldehyde, có sự hiện diện của ethidium bromide (Maniatis et al., 1982) thì phân tách được rARN với các tiểu phần 18S và 28S. Kết quả điện di ARN cho thấy, chúng tôi đã thu được ARN có chất lượng tốt với 2 băng có kích thước khoảng 2kb (rRNA 18S) và 3kb (rRNA 28S), không lẫn tạp hoặc đứt gãy (ảnh 4). Như vậy ARN tổng số thu được đảm bảo độ tinh sạch, sự nguyên vẹn phân tử để dùng cho thí nghiệm RT-PCR.

Từ kết quả trên, chúng tôi sơ bộ kết luận (a) kít trizol reagent phù hợp với phân lập ARN tổng số của lá bông sạch bệnh và bị bệnh xanh lùn và (b) điện di trên gel agarose chứa formaldehyde sẽ kiểm tra được chất lượng ARN tổng số.

4.3. Kết quả nhân gen bằng kỹ thuật PCR và RT-PCR

Dựa vào cấu trúc của chi Polerovirus, R.L. Corrêa và cs (2005) đã thiết kế từ trình tự đặc trưng đại diện các ORF (khung đọc mở) của chi: PL, PL2 (nhân gen RdRp: RNA lệ thuộc RNA polymerase) và PL4F-o3R (nhân gen CP). Chúng tôi đã sử dụng các trình tự này để thực hiện các phản ứng PCR và RT-PCR với ADN và ARN tổng số tách chiết từ mẫu lá bông sạch, bị bệnh và lá cây chổi đực. Kết quả cho thấy, khi sử dụng ADN tổng số của tất cả các loại mẫu làm khuôn, đều không thu được phân đoạn ADN nào. Trong khi đó, khi sử dụng cDNA tổng hợp từ ARN tổng số của mẫu lá bị bệnh xanh lùn làm khuôn với cặp mồi PL chúng tôi thu được một băng duy nhất với kích thước khoảng 800bp và với cặp mồi PL4F-o3R chúng tôi thu được một băng ADN với kích thước khoảng 400bp.

Sau khi tổng hợp được cDNA bằng phản ứng RT (sao mã ngược), chúng tôi dùng nó làm sợi khuôn cho các phản ứng PCR tiếp theo. Để thu được các đoạn gen với nồng độ cao, đặc hiệu, chúng tôi phải xác định điều kiện tối ưu cho phản ứng PCR. Ở tất cả các phản ứng PCR, chúng tôi tiến hành tìm nhiệt độ gắn mồi theo gradien. Kết quả đối với cặp mồi PL phù hợp với nhiệt độ gắn mồi 500C và cặp mồi PL4F-o3R phù hợp với nhiệt gắn mồi 46oC. Kết quả này không chênh lệch so với nghiên cứu của R.L. Corrêa năm 2005, nhiệt gắn mồi của 2 cặp là 50 và 45oC. Kết quả cũng cho thấy, ở giếng là những mẫu bệnh xuất hiện một băng, còn ở mẫu không bị bệnh thì không xuất hiện băng nào. Chúng tôi dự đoán băng xuất hiện có thể được nhân lên từ ARN của vi rút, nên chúng tôi tiếp tục sử dụng đoạn ADN này làm vật liệu để thực hiện các bước nghiên cứu tách dòng gen tiếp theo.

4.4. Kết quả tách dòng gen

Để tách dòng gen, toàn bộ các sản phẩm PCR được đưa vào vectơ pCR2.1, vectơ được biến nạp vào tế bào E.coli Top10F, tế bào được cấy trải trên môi trường LB đặc có bổ sung 50mg/l kanamycin + X-gal và nuôi cấy ở 370C qua đêm. Vi khuẩn nuôi qua đêm ở 370C mọc lên nhiều với cả khuẩn lạc xanh và trắng, khuẩn lạc tròn và rõ ràng.

Sau đó, để xác định lại kết quả tách dòng gen, chúng tôi đã chọn ngẫu nhiên 5 khuẩn lạc trắng/dòng, nuôi lắc trong môi trường LB lỏng có bổ sung 50mg/l kanamycin qua đêm, sau đó tách plasmid làm vật liệu để kiểm tra lại bằng enzym cắt hạn chế. Kết quả tách plasmid cho thấy, các khuẩn lạc xanh 6 và 12 (không được gắn ADN ngoại lai) có kích thước nhỏ hơn các khuẩn lạc trắng. ADN plasmid có 3 vạch rõ ràng, lượng nhiều và sạch, đủ tiêu chuẩn để làm các thí nghiệm tiếp theo.

Dựa vào sơ đồ vector pCR2.1 có 2 điểm cắt của enzym EcoRI nằm ở 2 đầu của đoạn gen được gắn, nên chúng tôi đã sử dụng enzym này để cắt plasmid tái tổ hợp thành vectơ và đoạn ADN ngoại lai riêng rẽ. Sau khi cắt chúng tôi đã thu được các sản phẩm phù hợp với tính toán ban đầu.



4.5. Kết quả xác định trình tự, so sánh trình tự và định loại vi rút

4.5.1. Kết quả xác định trình tự

Sau khi đã tách được dòng gen, chúng tôi đã chọn ba plasmid/dòng đã được tinh sạch và gửi đi đọc trình tự tại Phòng Công nghệ ADN ứng dụng, Viện Công nghệ Sinh học, Hà Nội. Kết quả đã đọc được 2 đoạn ADN có kích thước 770nt và 188nt. Trình tự ADN nhân được từ cặp mồi PL (nhân gen ORF2 mã hóa RdRp (RNA dependent RNA polymerase) chi tiết trong phụ lục và sau đây là kết quả so sánh với CLRDV (612nt).

Query 70 CGCCTCACGGTACAGAACAATTTACTGACGAGGCGCCTTCGAGCCTGCTGGCTCAGGTGC

|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||

CLRDV 70 CGCCTCACGGTACAGAACAACGGACTGACGAGGCGCCTTCGAGCCTGCTGGCTCAGGTGC
Query 130 ATATCTAACTCAGTTCTGTGCCTTTCAGACGGAACGCTGCTAACCCAACGAGTGGCTGGA

||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||

CLRDV 130 ATATCTAACTCAGTTCTGTGCCTTTCAGACGGAACGCTGCTGGCCCAACGAGTGGCTGGA
Query 190 GTGCAAAAGAGCGGTAGTTACAACACCAGCTCCTCCAACAGCAGAATCCGCGTTATGAAA

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

CLRDV 190 GTGCAAAAGAGCGGTAGTTACAACACCAGCTCCTCCAACAGCAGAATCCGCGTTATGAGT
Query 250 GCTTACCATTGTGGAGCCTCATGGGCGATGGCCATGGGCGATGATGCCCTTGAATCAGTG

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

CLRDV 250 GCTTACCATTGTGGAGCCTCATGGGCGATGGCCATGGGCGATGATGCCCTTGAATCAGTG
Query 310 GACACGGACCTATCCGTGTATAAACAATTAGGTTTTAAAGTCGAGGTGTCAGGAGAACTG

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

CLRDV 310 GACACGGACCTATCCGTGTATAAACAATTAGGTTTTAAAGTCGAGGTGTCAGGAGAACTG
Query 370 GAGTTCTGTTCTCATATCTTTCTTTCCCCTACCCTCGCCGTCCCGGTGAATAGAGCCAAG

|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

CLRDV 370 GAGTTCTGTTCTCATATCTTTCTTTCCCCTACCCTCGCCGTCCCGGTGAATAGAGCCAAA
Query 430 GTGCTCTACAAGCTCATACATGGGTATAACCCGGGATCAGGAAATCTGGAGGTTATCTCC

|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||

CLRDV 430 ATGCTCTACAAGCTCATACATGGCTATAACCCGGGATCAGGAAATCTGGAGGTTATCTCC
Query 490 AACTACCTGAACGCCTGTTTCAGCGTTTTAAACGAGTTGCGTTCAGACCCAGATTTCGTA

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

CLRDV 490 AACTACCTGAACGCCTGTTTCAGCGTTTTAAACGAGTTGCGTTCAGACCCAGATTTCGTA
Query 550 GCTCTCCTCTACTCGTGGCTCGTCACTCCAGTCTTGCCACAAAAGAACGATACAGAGGAT

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

CLRDV 550 GCTCTCCTCTACTCGTGGCTCGTCACTCCAGTCTTGCCACAAAAGAACGATACAGAGGAT
Query 610 TGA 612

|||


CLRDV 610 TGA 612

4.5.2. Kết quả so sánh trình tự và định loại vi rút

Sử dụng phần mềm Blastp để so sánh trình tự đoạn gen đã xác định với dữ liệu trên ngân hàng gen, kết quả so sánh trong bảng 2 cho thấy, trình tự của đoạn gen 770nt (tạm gọi là CLRDV-VN) chứa đoạn gen dài 533 nt tương đồng với gen RdRp của CLRDV là 97% (tương đồng protein) và 98% (tương đồng nucleotit). Vì vậy, chúng tôi cho rằng, 2 vi rút này có thể là cùng loài (theo định nghĩa loài trong chi Luteoviridae: vi rút có CP và RpRd tương đồng trên 90% được coi là cùng loài - hướng dẫn phân loại các loài vi rút, Van Regenmortel MH và cs., 1997). Bên cạnh đó, CLRDV-VN cũng tương đồng với hầu hết các loài trong chi Polerovirus với tỷ lệ trên 70% (77% với BMYV và TVDV; 76% với TYV; 75% với PLRV…). Qua so sánh, chúng tôi không tìm thấy sự tương đồng với SbDV, kết quả này là hợp lý vì SbDV có RdRp thuộc về chi Luteovirus (Rathjen và cs., 1994; Terauchi và cs., 2001). Tương tự như vậy, chúng tôi cũng không thấy sự tương đồng giữa CLRDV-VN với BLRV và GRAV (hai thành viên khác của chi Luteovirus) khi sử dụng phần mềm so sánh này. Kết quả này cho thấy, RdRp của CLRDV-VN có quan hệ gần với các loài trong chi Polerovirus hơn Luteovirus.

Bảng 2. Kết quả so sánh tương đồng của gen RdRp

(http://www.ncbi.nlm.nih.gov) theo chương trình tblastp-chi tiết trong phụ lục 6



Tên viết tắt

Loài

Tỷ lệ tương đồng (%)

CLRDV

Cotton leafroll dwarf virus

97

BMYV

Beet mild yellowing virus

77

TVDV

Tobacco vein distorting polerovirus

77

TYV

Turnip yellows virus

76

PLRV

Potato leafroll virus

75

BWYV

Beet western yellows virus

72

CpChSV

Chickpea chlorotic stunt virus

73

BChV

Beet chlorosis virus

72

CabYV

Cucurbit aphid-borne yellows virus

74

BYDV

Barley yellow dwarf virus

72

CYDV

Cereal yellow dwarf virus

70

ScYLV

Sugarcane yellow leaf virus

64

BLRV

Bean leafroll virus

-

SbDV

Soybean dwarf virus

-

GRAV

Groundnut rosette assistor virus

-

PeMV

Pea enation mosaic virus

50

Đối với đoạn gen nhân bằng cặp mồi PL4F&o3R nhân vùng ORF3 (CP gen), chúng tôi đã nhân được một đoạn lý thuyết khoảng 400 nt (ảnh 6). Rất tiếc, sau khi tách dòng và đọc trình tự chỉ xác định được một đoạn 188 nucleotit. Đoạn này quá ngắn, không có ý nghĩa thống kê khi so sánh tương đồng (theo Pearson năm 2000 thì trình tự sử dụng để so sánh phải lớn hơn 200 nucleotit, lý tưởng khoảng 1.000 nucleotit). Vì vậy, chúng tôi sẽ tiến hành tách dòng và đọc trình tự lại trong thời gian tới.

Qua đây, chúng tôi sơ bộ kết luận, vi rút gây bệnh xanh lùn ở Việt Nam thuộc họ Luteoviridae.



5. KẾT KUẬN VÀ ĐỀ NGHỊ

5.1. Kết luận

  1. Thu thập, phân lập và tạo mẫu bệnh tự nhiên và nhân tạo, mẫu lá sạch bệnh, nhiễm bệnh nhân tạo của cây bông và cây ký chủ bệnh xanh lùn đủ cho nghiên cứu tách chiết AND và ARN tổng số.

  2. Đã tách chiết thành công ARN tổng số lá bông theo phương pháp sử dụng Trizol reagent của Invitrogen cho 3 loại mẫu lá bị bệnh xanh lùn tự nhiên, bị bệnh xanh lùn nhân tạo và không bị bệnh xanh lùn. Đã điện di thành công ARN tổng số trên gel agarose chứa formaldehyde.

  3. Thực hiện thành công phản ứng Reverse-PCR giữa ARN tổng số với các 2 cặp mồi đặc hiệu nhân gen RdRp và CP. Đoạn gen nhân được có kích thước khoảng 800nt và 400nt.

  4. Đã tách dòng và xác định được một đoạn 770nt trình tự và so sánh một đoạn 533nt thuộc gen RdRp của vi rút.

  5. Vi rút gây bệnh xanh lùn bông ở Việt Nam thuộc họ Luteoviridae.

5.2. Đề nghị

Tiếp tục nghiên cứu, tách dòng cho gen mã hóa protein vỏ vi rút. So sánh và xác định rõ chi của vi rút này.





  1   2


Cơ sở dữ liệu được bảo vệ bởi bản quyền ©hocday.com 2019
được sử dụng cho việc quản lý

    Quê hương