MỤc lụC ĐẶt vấN ĐỀ


II. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU



tải về 370.03 Kb.
trang2/4
Chuyển đổi dữ liệu19.07.2016
Kích370.03 Kb.
1   2   3   4

II. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU

2.1. Vật liệu nghiên cứu

Vật liệu nghiên cứu là 34 giống lúa kháng đạo ôn được thu thập ở nhiều địa phương khác nhau, đang được lưu giữ và bảo tồn tại ngân hàng gen hạt của Trung tâm Tài nguyên Thực vật (Bảng 2.1)



Bảng 2.1: Danh sách 34 giống lúa kháng đạo ôn nghiên cứu

TT

SĐK

Tên giống

Kí hiệu

TT

SĐK

Tên giống

Kí hiệu

1

958

Tan lanh

Đ1

18

3612

Plẩu tâu đằng dạng 2

Đ18

2

1980

Nếp nương cẩm

Đ2

19

4180

Nếp cái đỏ

Đ19

3

2049

Nếp râu

Đ3

20

4855

Đle tư

Đ20

4

2071

I mèo

Đ4

21

7006

Nếp lùn

Đ21

5

2079

Lâu châu plat

Đ5

22

7095

Kháu hạng khoai

Đ22

6

2119

San pa toong

Đ6

23

7686

Ple lia

Đ23

7

2131

Đle la tong

Đ7

24

8222

Khẩu lếch

Đ24

8

2134

Đle te lo

Đ8

25

8225

Khẩu tan nhe

Đ25

9

2136

Đ'le p'lu

Đ9

26

8235

Kháu hút đạnh

Đ26

10

2156

Lúa venth

Đ10

27

8673

Kháu mặc Đuộc

Đ27

11

2173

Lúa length

Đ11

28

8709

Plề chớ

Đ28

12

2380

Nếp cẩm

Đ12

29

9209

Đất tam Đăng

Đ29

13

2431

Chiêm ngân

Đ13

30

9408

Ló đếp cẩm

Đ30

14

2432

Chiêm nhỡ Bắc Ninh 2

Đ14

31




OM5471

Đ31

15

2484

Khẩu giăng căm

Đ15

32




OM 5629

Đ32

16

2629

Đ'le la

Đ16

33




OM8923

Đ33

17

3345

Lúa gốc đỏ

Đ17

34




OM6377

Đ34

Trong nghiên cứu này chúng tôi sử dụng 29 cặp mồi SSR thuộc các locus RM được chọn lọc từ 2240 cặp mồi để phân tích đa dạng di truyền các giống lúa kháng đạo ôn. Các cặp mồi do hãng Operon cung cấp dựa vào các thông tin về trình tự, kích thước, số allele chuẩn trên mỗi locus, vị trí phân bố của các locus ở trên 12 NST của bộ gen lúa.

Bảng 2.2: Thông tin về các cặp mồi trong nghiên cứu

TT

Tên mồi

Trình tự mồi

NST

Kích thước (bp)

1

RM13

3’-TCCAACATGGCAAGAGAGAG-5’

5’-GGTGGCATTCGATTCCAG-3’



5

124-154

2

RM17

3’-TGCCCTGTTATTTTCTTCTCTC-5’

5’-GGTGATCCTTTCCCATTTCA-3’



12

160-171

3

RM135

3’-CTCTGTCTCCTCCCCCGCGTCG-5’

5’-TCAGCTTCTGGCCGGCCTCCTC-3’



3

119-131

4

RM138

3’-AGCGCAACAACCAATCCATCCG-5’

5’-AAGAAGCTGCCTTTGACGCTATGG



2

104-155

5

RM142

3’-CTCGCTATCGCCATCGCCATCG-5’

5’-TCGAGCCATCGCTGGATGGAGG-3’



4

235-238

6

RM143

3’-GTCCCGAACCCTAGCCCGAGGG-5’

5’-AGAGGCCCTCCACATGGCGACC-3’



3

195-207

7

RM153

3’-GCCTCGAGCATCATCATCAG-5’

5’-ATCAACCTGCACTTGCCTGG-3’



5

196-234

8

RM156

3’-GCCGCACCCTCACTCCCTCCTC-5’

5’-TCTTGCCGGAGCGCTTGAGGTG-3’



3

150-160

9

RM161

3’-TGCAGATGAGAAGCGGCGCCTC-5’

5’-TGTGTCATCAGACGGCGCTCCG-3’



5

165-189

10

RM162

GCCAGCAAAACCAGGGATCCGG

CAAGGTCTTGTGCGGCTTGCGG



6




11

RM171

3’-AACGCGAGGACACGTACTTAC-5’

5’-ACGAGATACGTACGCCTTTG-3’



10

310-356

12

RM172

3’-TGCAGCTGCGCCACAGCCATAG-5’

5’-CAACCACGACACCGCCGTGTTG-3’



7

159-165

13

RM174

3’-AGCGACGCCAAGACAAGTCGGG-5’

5’-TCCACGTCGATCGACACGACGG-3’



2

207-222

14

RM224

3’-ATCGATCGATCTTCACGAGG-5’

5’-TGCTATAAAAGGCATTCGGG-3’



11

120-152

15

RM229

CACTCACACGAACGACTGAC

CGCAGGTTCTTGTGAAATGT



1




16

RM241

GAGCCAAATAAGATCGCTGA

TGCAAGCAGCAGATTTAGTG




2

98-158

17

RM245

3’-ATGCCGCCAGTGAATAGC-5’

5’-CTGAGAATCCAATTATCTGGGG-3’



9

136-146

18

RM257

3’-CAGTTCCGAGCAAGAGTACTC-5’

5’-GGATCGGACGTGGCATATG-3’



9

120-170

19

RM261

CTACTTCTCCCCTTGTGTCG

TGTACCATCGCCAAATCTCC



4




20

RM270

3’-GGCCGTTGGTTCTAAAATC-5’

5’-TGCGCAGTATCATCGGCGAG-3’



12

104-117

21

RM282

CTGTGTCGAAAGGCTGCAC

CAGTCCTGTGTTGCAGCAAG



3

129-150

22

RM286

3’-GGCTTCATCTTTGGCGAC-5’

5’-CCGGATTCACGAGATAAACTC-3’



11

99-128

23

RM302

3’-TCATGTCATCTACCATCACAC-5’

5’-ATGGAGAAGATGGAATACTTGC-3’



1

120-191

24

RM310

CCAAAACATTTAAAATATCATG

GCTTGTTGGTCATTACCATTC






85-120

25

RM323

3’-CAACGAGCAAATCAGGTCAG-5’

5’-GTTTTGATCCTAAGGCTGCTG-3’



1

241-244

26

RM337

3’-GTAGGAAAGGAAGGGCAGAG-5’

5’-CGATAGATAGCTAGATGTGGCC-3’



8

154-194

27

RM340

3’-GGTAAATGGACAATCCTATGGC-5’

5’-GACAAATATAAGGGCAGTGTGC-3’



6

118-191

28

RM341

3’-CAAGAAACCTCAATCCGAGC-5’
5’-CTCCTCCCGATCCCAATC-3’

2

126-186

29

RM345

3’-ATTGGTAGCTCAATGCAAGC-5’

5’-GTGCAACAACCCCACATG-3’



6

152-167


2.2. Phương pháp nghiên cứu

2.2.1. Tách chiết ADN: Mẫu lá của từng dòng được thu thập riêng rẽ và tách chiết ADN tổng số theo phương pháp CTAB của Obara và Kako (1998) [42] có cải tiến.

  1. Chuẩn bị sẵn dung dịch đệm chiết CTAB ở 600C.

  2. Nghiền 0,3 gam mẫu lá bằng chày cối sứ vô trùng trong nitơ lỏng đến khi thành dạng bột mịn.

  3. Hoà tan mẫu đã nghiền nhỏ trong 800l CTAB buffer và 60l SDS 10%.

  4. Ủ mẫu ở 650C trong bể ổn nhiệt, thời gian 60 phút.

  5. Bổ sung hỗn hợp CHCl3-IsoA (24:1) với tỷ lệ 1:1 về thể tích so với dịch mẫu. Lắc nhẹ, ly tâm 12000 vòng/phút trong 10 phút ở nhiệt độ phòng. Hút dung dịch phía trên chuyển sang ống mới.

  6. Tiếp tục chiết lần 2 bằng hỗn hợp CHCl3-IsoA (24:1). Thu được dịch chiết chứa ADN.

  7. Tủa ADN bằng ethanol đã làm lạnh. Để ở -200C trong 1 giờ.

  8. Ly tâm thu tủa 14000 vòng/phút trong 15 phút ở 40C.

  9. Rửa tủa bằng etanol 70%, ly tâm thu tủa, làm khô và hoà tan trong đệm TE.

  10. Độ tinh sạch và nồng độ DNA tổng số được kiểm tra bằng cách điện di trên gel agarose 1% cùng với lader DNA 25g/l.

2.2.2. Phản ứng PCR

Mỗi phản ứng PCR bao gồm các thành phần và hàm lượng cụ thể như sau:



TT

Thành phần

Thể tích (µl)

1

Nước cất hai lần khử ion

3,2

2

Đệm PCR 10X + MgCl2 25mM

1

3

dNTPs 10mM

1,0

4

Taq DNA polymerase 1U/µl

0,8

5

Mồi xuôi 5µM

1,5

6

Mồi ngược 5µM

1,5

7

DNA 10g/µl

1

Tổng thể tích của một phản ứng

10,0

Điều kiện phản ứng PCR:

Các bước

Nhiệt độ (oC)

Thời gian

Số chu kỳ

I

94

5 phút

1

II

94

45 giây

35

72

1 phút

72

1 phút

III

72

8 phút

1

V

4

30 phút

1

: phenotype -> upload -> article
article -> MỤc lục báo cáo kết quả thực hiện chuyêN ĐỀ nghiên cứu khoa họC (Chuyên đề 7)
article -> Khóa luận tốt nghiệp Bùi Thị Linh LỜi cảM ƠN
article -> BÁo cáo kết quả thực hiện chuyêN ĐỀ nghiên cứu khoa họC (Chuyên đề 5)
article -> 1. 1 Vài nét sơ lược về cây lú
article -> ĐẶt vấN ĐỀ 2 I. TỔng quan nghiên cứU 3
article -> ĐÁnh giá Đa dạng di truyền tậP ĐOÀn giống lúa có khả NĂng chịu hạn bằng chỉ thị phân tử ssr
article -> MỤc lụC 1 Triệu chứng bệnh 4
article -> Đặc biệt, nhu cầu về các giống lúa có chất lượng cao ngày càng gia tăng trong những thập kỷ gần đây, do yêu cầu của thị trường và nhu cầu của người tiêu dùng
article -> Xanthomonas oryzea pv oryze, đ
article -> ChuyêN ĐỀ 1 Tách chiết adn với số lượng cực lớn, chất lượng cao của 30 giống lúa


1   2   3   4


Cơ sở dữ liệu được bảo vệ bởi bản quyền ©hocday.com 2019
được sử dụng cho việc quản lý

    Quê hương