Luận văn Thạc sỹ 2007 2009



tải về 2.24 Mb.
trang1/2
Chuyển đổi dữ liệu02.06.2018
Kích2.24 Mb.
  1   2

Luận văn Thạc sỹ 2007 – 2009

======================================================

MỞ ĐẦU

Trong dinh dưỡng động vật, việc tăng cường sức khoẻ hệ thống tiêu hoá của vật nuôi thông qua những tác động tới hệ vi sinh vật đường ruột được coi là một giải pháp rất hữu hiệu. Hệ vi sinh vật đường ruột của vật nuôi rất phong phú về chủng loại và số lượng, những biến động về cơ cấu, số lượng các loài vi sinh vật đường ruột là một trong những nguyên nhân chủ yếu dẫn đến những rối loạn trong tiêu hoá và hấp thu. Bởi vậy, việc sử dụng các biện pháp kỹ thuật thông qua thức ăn và nuôi dưỡng nhằm tạo nên một thế cân bằng tối ưu giữa các loài vi sinh vật đường ruột theo hướng có lợi cho vật chủ đã và đang là hướng nghiên cứu được các nhà nghiên cứu trong và ngoài nước quan tâm. Có nhiều biện pháp để cải thiện quan hệ cân bằng giữa các nhóm vi khuẩn có lợi và có hại trong đường tiêu hoá của gia súc, gia cầm. Biện pháp cổ điển được ứng dụng rộng rãi từ những năm 1950 của thế kỷ trước là sử dụng kháng sinh liều thấp. Tuy nhiên, việc sử dụng kháng sinh trong thức ăn chăn nuôi ngày càng bị hạn chế (kể từ ngày 01 tháng 01 năm 2006, các nước thuộc EU cấm hoàn toàn việc sử dụng kháng sinh trong thức ăn chăn nuôi -Hector Cervanter, 2006), nên nhu cầu tìm ra các giải pháp thay thế kháng sinh ngày càng trở thành cấp bách. Một trong những giải pháp hữu hiệu nhất hiện nay là probiotic. Probiotic - theo Fuller (1992)- là chất bổ sung vi sinh vật sống hữu ích trong thức ăn nhằm cải thiện sự cân bằng hệ vi sinh vật đường ruột theo hướng có lợi cho vật chủ.

Các sản phẩm probiotic nhập khẩu dùng trong chăn nuôi có mặt trên thị trường Việt Nam nhiều nhưng các đáp ứng tích cực cho vật nuôi chưa được rõ ràng. Các nhà khoa học cho rằng có thể là các vi sinh vật đó không phù hợp với hệ vi sinh vật đường ruột của vật chủ bản địa. Mặt khác, các nghiên cứu sản xuất các chế phẩm probiotic dùng trong chăn nuôi ở nước ta còn rất hạn chế. Chúng tôi thực hiện đề tài: “Phân lập và tuyển chọn các chủng vi sinh vật hữu ích phục vụ cho việc sản xuất các chế phẩm probiotic dùng trong chăn nuôi” với định hướng đưa ra được các giải pháp công nghệ để sản xuất các chế phẩm nói trên bằng các nguyên liệu trong nước. Đề tài này được thực hiện thành công sẽ mở ra triển vọng trong việc sản xuất các sản phẩm sinh học chất lượng cao, đáp ứng với yêu cầu ngày càng cao của ngành chăn nuôi hữu cơ (hoàn toàn dựa vào các nguyên liệu từ thiên nhiên) theo hướng công nghiệp ở nước ta, hạn chế nhập khẩu.

Chương 1 – TỔNG QUAN

1.1. Lịch sử và định nghĩa probiotic

1.1.1. Lịch sử probiotic

Những nghiên cứu về probiotic mới chỉ bắt đầu vào thế kỷ 20, Henry Tisser (1900), một bác sỹ người Pháp đã quan sát và thấy rằng phân của những đứa trẻ mắc bệnh tiêu chảy có ít vi khuẩn lạ hình trứng hoặc hình chữ Y hơn những đứa trẻ khỏe mạnh [53].

Sau đó năm 1907, Elie Metchnikoff - người Nga, đạt giải Nobel – đã chứng minh được rằng việc tiêu thụ Lactobacillus sẽ hạn chế các nội độc tố của hệ vi sinh vật đường ruột. Ông giải thích được điều bí ẩn về sức khỏe của những người Cô-dăc ở Bulgary, họ sống rất khỏe mạnh và tuổi thọ có thể lên tới 115 tuổi hoặc hơn, nguyên nhân có thể là do họ tiêu thụ rất lớn các sản phẩm sữa lên men, điều này được ông báo cáo trong sách “sự kéo dài cuộc sống” – The Prolongation of life (1908) [53].

Có thể nói Tisser và Metchnikoff là người đầu tiên đưa ra những đề xuất mang tính khoa học về probiotic, làm cơ sở cho những nghiên cứu tiếp theo về probiotic [26].

Năm 1930, nhà khoa học người Nhật Minoru Shirota phân lập các vi khuẩn lactic từ phân của các em thiếu nhi khỏe mạnh [27]. Cùng năm đó, các nhà nghiên cứu Hoa Kỳ đã chứng minh là Lactobacillus acidophilus có khả năng làm giảm bệnh táo bón thường xuyên. Các nhà khoa học đại học Havard phát hiện ra các vi khuẩn đường ruột đóng một vai trò quyết định trong quá trình tiêu hóa, giúp tiêu hóa thức ăn, cung cấp một số vitamin và các chất dinh dưỡng khác nhau mà cơ thể vật chủ không tự sản xuất ra được [26]. Sau đó 5 năm, một trong các đồ uống lên men – đặt tên là “Yakult” từ sữa được cho là hỗ trợ sức khỏe đường ruột (intestinal health) được sản xuất. Khái niệm chung probiotics được chấp nhận ở Châu Á trong nhiều năm khi các sản phẩm lên men từ sữa probiotic đầu tiên được giới thiệu ở Châu Âu những năm của thập niên 80 [27].

Ngày nay, các sản phẩm probiotic có chứa Bifidobacteria hoặc Lactobacillus được tiêu thụ rộng rãi và phổ biến trên khắp thế giới như những nguồn thực phẩm chính giúp tăng cường sức khỏe cho con người cũng như vật nuôi.

1.1.2. Định nghĩa probiotic

Theo ngôn ngữ Hi Lạp, probiotic có nghĩa là “vì sự sống”. Thuật ngữ probiotic được Parker đề nghị sử dụng lần đầu tiên vào năm 1974 để chỉ “những vi sinh vật và những chất làm cân bằng hệ vi sinh vật ruột” (Fuller, 1989). Từ đó đến nay thuật ngữ probiotic đã được cả thế giới sử dụng để chỉ những chế phẩm vi sinh vật sống hữu ích khi được đưa vào cơ thể động vật thông qua thức ăn hoặc nước uống tạo nên những ảnh hưởng có lợi cho vật chủ. Kể từ khi xuất hiện, khái niệm probiotic vẫn chưa có một định nghĩa thống nhất. Tuy nhiên, hiện có hai định nghĩa được cho là phản ánh khá đầy đủ bản chất của probiotic và được sử dụng nhiều trong các ấn phẩm khoa học: (i) theo Fuller (1989), probiotic là “chất bổ sung vi sinh vật sống vào thức ăn giúp cải thiện cân bằng của hệ vi sinh vật đường tiêu hóa theo hướng có lợi cho vật chủ”; (ii) theo tổ chức Y tế thế giới (WHO, 2001), probiotic là “các vi sinh vật sống khi đưa vào cơ thể theo đường tiêu hoá với một số lượng đủ sẽ đem lại sức khoẻ tốt cho vật chủ”.

1.2. Hệ vi sinh vật đường ruột và tác động của hệ vi sinh vật đến sức khỏe của vật nuôi

Bên cạnh sự hấp thụ các chất dinh dưỡng, đường tiêu hóa còn đóng vai trò quan trọng như là cơ quan miễn dịch lớn nhất trong cơ thể. Do đó, nó là hệ thống bảo vệ và là hàng rào quan trọng chống lại các tác nhân gây bệnh xâm nhiễm. Thêm vào các cơ chế bảo vệ nói chung, hệ thống miễn dịch, với các phản ứng đặc hiệu và không đặc hiệu, giúp chống lại các vi sinh vật gây bệnh. Khu hệ vi sinh vật đường ruột cũng được coi là một trong các yếu tố chống lại các tác nhân gây bệnh [36].

Khi còn ở trong bào thai, đường tiêu hoá của vật nuôi ở trạng thái vô trùng, nhưng chỉ vài giờ sau khi sinh các vi sinh vật đã bắt đầu cư trú và trở thành những “cư dân” bình thường trong đường tiêu hoá (WHO, 2001). Theo thời gian, do tiếp xúc trực tiếp với môi trường, đặc biệt là qua thức ăn và nước uống, số lượng và tính đa dạng sinh học của các vi sinh vật cộng sinh không ngừng tăng lên. Số lượng tế bào vi sinh vật cư trú trong đường tiêu hóa của vật nuôi có thể cao gấp mười lần số lượng tế bào cấu tạo nên cơ thể chúng (Fonty, 1995). Số lượng loài có thể lên tới từ 400-500 (Tannock, 1999). Tuy nhiên, mật độ vi sinh vật ở các phân đoạn khác nhau của đường tiêu hóa (dạ dày; tá tràng; ruột non và ruột già) ở loài động vật dạ dày đơn rất khác nhau (khoảng 101-103; 101-104; 105-108 và 109-1012 cfu/ml chất chứa tương ứng) (Jans, 2005).

Sức khỏe của vật nuôi phụ thuộc vào 3 yếu tố chính: trạng thái sinh lý của vật chủ, khẩu phần thức ăn và hệ vi sinh vật. Các yếu tố này chịu tác động của môi trường, của các stress và tác động qua lại lẫn nhau. Trong số các nhân tố trên, hệ vi sinh vật đường tiêu hóa đóng vai trò trung tâm, chỉ một biến động bất lợi của một trong hai yếu tố còn lại cũng ảnh hưởng xấu tới hệ vi sinh vật (Conway, 1994). Sự cộng sinh của các loài vi sinh vật trong đường tiêu hoá của vật nuôi (chủ yếu là trong ruột) tạo nên một hệ sinh thái mở và mối cân bằng của quần thể vi sinh vật được xác lập chỉ một thời gian rất ngắn sau khi sinh (Jans, 2005).



Có nhiều quan điểm khác nhau về mối tương quan cân bằng của hệ vi sinh vật ruột. Theo Jans (2005), để đánh giá trạng thái cân bằng, các vi sinh vật ruột được chia thành 3 nhóm (1) nhóm chủ yếu (main flora) gồm các loài vi khuẩn kị khí (Clostridium; Lactobacillus; Bifidobacteria; Bacteroides, Eubacteria); (2) nhóm vệ tinh (Satellite flora), gồm chủ yếu là EnterococcusE. coli, và (3) nhóm còn lại (Residual flora) gồm các vi sinh vật có hại như Proteus, Staphylococcus và Pseudomonas… Một quần thể vi sinh vật được coi là cân bằng khi tỷ lệ của các nhóm dao động trong khoảng 90; 1,0 và 0,01% tương ứng. Trạng thái mà các nhóm này hình thành một tỷ lệ 90:1:0,01 được gọi là trạng thái “eubiosis” (tiếng Hy Lạp có nghĩa là sự chung sống có lợi giữa các vi khuẩn với nhau và với vật chủ). Ở trạng thái “eubiosis”, vật chủ cung cấp các điều kiện sống lý tưởng như nhiệt độ ổn định, pH trung tính, dinh dưỡng và sự đào thải các chất chuyển hóa. Đổi lại, hệ vi sinh vật sẽ mang lại lợi ích cho vật chủ thông qua tăng cường tiêu hóa các chất dinh dưỡng, giải độc, tổng hợp các vitamin nhóm B và vitamin K, loại trừ các vi sinh vật có hại, tăng cường đáp ứng miễn dịch của vật chủ. Sự cân bằng của hệ vi sinh vật trong đường tiêu hóa bị tác động bởi một số nhân tố vô sinh và hữu sinh như: sinh lý vật chủ, khẩu phần thức ăn và cơ cấu nội tại của bản thân hệ vi sinh vật. Thức ăn là nền dinh dưỡng cơ bản của vi sinh vật, bởi vậy sự thay đổi thành phần khẩu phần, thức ăn không đảm bảo vệ sinh, phương pháp cho ăn không hợp lý... đều làm tổn hại đến trạng thái cân bằng hệ vi sinh vật ruột. Tương tự như vậy, các chất bài tiết của hệ tiêu hóa (dịch mật, các enzym, chất đệm và chất nhầy...) cũng như kiểu và tần số nhu động ruột cũng tác động trực tiếp đến hệ vi sinh vật. Kiểu và tần số nhu động ruột bị tác động rất lớn bởi các stress (sinh đẻ, cai sữa, dồn chuồng, vận chuyển...). Khi quan hệ cân bằng của hệ vi sinh vật ruột bị phá vỡ sẽ tạo nên trạng thái “dysbiosis” (trạng thái “chung sống có hại”). Biểu hiện của trạng thái “dysbiosis” ở vật chủ thường là thể tạng kém, sinh trưởng chậm và mắc các bệnh đường tiêu hóa như tiêu chảy, viêm ruột hoại tử... (tóm tắt trạng thái eubiosis và dysbiosis có trong bảng 1). Để cải thiện quan hệ cân bằng của hệ vi sinh vật ruột ở vật nuôi, một phương pháp thường được áp dụng là bổ sung vào khẩu phần thức ăn một số loại kháng sinh liều thấp như những chất kích thích sinh trưởng. Tuy nhiên, việc sử dụng kháng sinh trong thức ăn chăn nuôi một cách không có kiểm soát đã và đang gây ra những hậu quả đáng lo ngại về vệ sinh an toàn thực phẩm và đặc biệt là gây nên tình trạng kháng thuốc ngày càng gia tăng của các vi khuẩn gây bệnh trên người và vật nuôi. Hiện nay, khối liên minh châu Âu (EU) đã cấm sử dụng kháng sinh để bổ sung vào thức ăn như chất kích thích sinh trưởng từ ngày 01 tháng 01 năm 2006. Việc cấm sử dụng kháng sinh trong thức ăn chăn nuôi cũng đặt ra những thách thức lớn về kỹ thuật, đặc biệt đối với chăn nuôi gia súc, gia cầm non hoặc trong điều kiện vệ sinh kém và vật nuôi chịu nhiều stress. Để vượt qua những thách thức đó, đã có rất nhiều những nghiên cứu nhằm tìm ra tác nhân để thay thế kháng sinh nhưng an toàn với vật nuôi. Một trong những tác nhân tìm ra đó là probiotic.

Bảng 1: Tóm tắt trạng thái Eubiosis và Dysbiosis cùng các đặc điểm đặc trưng của chúng

Trạng thái Eubiosis

- Sự cùng tồn tại giữa vật chủ và hệ vi sinh vật đường ruột – Sự cộng sinh

- Sự bảo vệ bề mặt của đường tiêu hóa chống lại các vi sinh vật xâm nhiễm.
- Kích thích hệ miễn dịch của vật chủ.

- Tiêu hóa các chất dinh dưỡng.

- Tổng hợp protein.

- Tổng hợp các vitamin



Trạng thái Dysbiosis

- Sự không cùng tồn tại giữa vật chủ và hệ vi sinh vật đường ruột.

- Sự phá hủy biểu mô đường ruột, làm cho thành đường ruột mỏng đi dẫn đến giảm sự hấp thụ các chất dinh dưỡng.

- Sinh ra các cơ chất gây độc (NH3, chất độc…)

- Phân hủy, tăng sản sinh khí gas (CH4, H2S, CO2).

- Làm yếu hệ thống miễn dịch

- Làm tăng chu trình tế bào, cần nhiều năng lượng


1.3. Vai trò và cơ chế hoạt động của probiotic

1.3.1. Vai trò của probiotic

Từ khi kháng sinh bị cấm sử dụng như chất kích thích sinh trưởng trong thức ăn chăn nuôi ở một số nước thuộc khối liên minh châu Âu (bắt đầu là Thụy Điển vào năm 1986) thì probiotic được coi là một trong những nguồn thay thế có triển vọng nhất vì có nhiều đặc tính ưu việt. Trên cơ sở các kết quả nghiên cứu của nhiều tác giả, Patterson (2003) đã tổng kết các ảnh hưởng có lợi của probiotic đối với đời sống động vật thể hiện ở các khía cạnh sau:

- Thay đổi cấu trúc quần thể vi sinh vật đường ruột theo chiều hướng có lợi cho vật chủ.

- Tăng cường khả năng miễn dịch.

- Giảm phản ứng viêm.

- Ngăn cản sự xâm nhập và ức chế sự phát triển của vi khuẩn gây bệnh.

- Tăng sản xuất các axit béo bay hơi.

- Tăng cường quá trình sinh tổng hợp các vitamin nhóm B.

- Tăng hấp thu chất khoáng.

- Làm giảm cholesterol huyết thanh.

- Làm tăng năng suất vật nuôi.

- Giảm hàm lượng amoniac và urê trong chất thải.

Ngoài ra probiotic còn rất an toàn với động vật và thân thiện với môi trường. Vì là chất bổ sung vi sinh vật sống hữu ích, việc sử dụng probiotic sẽ không tạo ra các chất tồn dư trong các sản phẩm chăn nuôi có hại cho sức khỏe người tiêu dùng.

1.3.2. Cơ chế tác động

Có rất nhiều cách giải thích khác nhau về cơ chế tác động, nhưng phần lớn các tài liệu về probiotic đề cập đến ba khía cạnh sau: (i) cạnh tranh loại trừ; (ii) đối kháng vi khuẩn và (iii) điều chỉnh miễn dịch (Steiner, 2006). Minh họa cơ chế hoạt động của probiotic thông qua hình 1.

Cạnh tranh loại trừ là đặc tính đấu tranh sinh tồn điển hình của các vi sinh vật. Hình thức cạnh tranh loại trừ thường thấy ở các vi sinh vật ruột là cạnh tranh vị trí bám dính. Các vi sinh vật probiotic cư ngụ và nhân lên trong ruột, khóa chặt các vị trí thụ cảm và ngăn cản sự bám dính của các vi sinh vật khác như E. coli, Salmonella... Một số nấm men probiotic (Saccharomyces cereviese; S.boulardii) không chỉ tranh vị trí bám dính của các vi khuẩn khác mà còn gắn kết các vi khuẩn có roi (phần lớn là những vi khuẩn có hại) thông qua các cơ quan thụ cảm mannose và đẩy chúng ra khỏi vị trí bám dính ở niêm mạc ruột (Czerucka và Rampal, 2002). Tuy nhiên, cạnh tranh dinh dưỡng là phương thức cạnh tranh khốc liệt nhất vì sự sinh sôi với số lượng lớn của một loài vi sinh vật nào đó là một đe dọa nghiêm trọng đối với các loài khác về nguồn cơ chất cho phát triển.

Đồng thời với cạnh tranh loại trừ, các vi sinh vật probiotic còn sản sinh các chất kìm hãm vi khuẩn như lactoferrin, lysozym, hydrogen peroxide cũng như một số axit hữu cơ khác. Các chất này gây tác động bất lợi lên vi khuẩn có hại chủ yếu là do sự giảm thấp pH trong ruột (Conway, 1996).



Phản ứng miễn dịch được kích thích và hoạt tính kháng thể của vật chủ tăng lên




Cạnh tranh chất dinh dưỡng: các sinh vật probiotic cạnh tranh với các vi sinh vật gây bệnh các chất dinh dưỡng quan trọng.




Cạnh tranh loại trừ: các sinh vật probiotic khóa chặt các vị trí thụ cảm do đó loại trừ được các vi sinh vật gây bệnh



Màng chắn: nơi các sinh vật probiotic chiếm giữ các thụ cảm trên bề mặt ruột, độc tố được loại trừ




Gây bệnh: các vi sinh vật gây bệnh và chất độc của chúng bám vào niêm mạc và các thụ cảm trên ruột và phá hủy chúng




Các vi sinh vật probiotic cư ngụ và nhân lên trong ruột, ngăn cản sự bám dính và phát triển của các vi sinh vật gây bệnh

Hình 1. Minh hoạ cơ chế tác động của probiotic

Ruột là cơ quan miễn dịch lớn nhất ở động vật có vú. Giữa hệ vi sinh vật ruột và hệ thống miễn dịch có mối tương tác đặc thù. Năng lực miễn dịch thể dịch và miễn dịch tế bào của hệ thống miễn dịch đường ruột bị ảnh hưởng rất lớn bởi sự cân bằng của hệ vi sinh vật ruột (Cebra, 1999). Thông qua tương tác với hệ thống miễn dịch ruột, các probiotic có thể điều chỉnh cả miễn dịch thụ động và chủ động hoặc cả hai. Tác động điều chỉnh miễn dịch đặc hiệu của probiotic phụ thuộc vào chủng giống hoặc các loài vi khuẩn probiotic (Dugas và ctv, 1999). Tuy nhiên, cơ chế tác động của probiotic đối với việc nâng cao chức năng miễn dịch vẫn còn chưa được hiểu biết đầy đủ.

1.4. Tiêu chuẩn lựa chọn chủng vi sinh vật probiotic

1.4.1. Lựa chọn các chủng probiotic

Việc lựa chọn các chủng vi sinh vật với tiêu chuẩn đầu tiên là phải an toàn cho quá trình sản xuất và ứng dụng, có khả năng sống sót và chiếm lĩnh (colonization) trong đường tiêu hóa vật chủ. Các tiêu chuẩn lựa chọn này được hợp lý hóa thông qua các thí nghiệm in vitro, từ đó sẽ tuyển chọn được các chủng có tiềm năng như là nguồn probiotic [22].

Các chủng vi sinh vật probiotic được lựa chọn theo các tiêu chuẩn chủ yếu sau:



  • Tính bám dính trên bề mặt đường tiêu hóa hoặc các tế bào biểu mô: Các chủng probiotic phải bám dính được vào thành ruột non, khu trú tốt trong đường tiêu hoá và sinh sôi nảy nở. Khả năng bám dính được xem là một yêu cầu quan trọng để tăng khả năng ức chế vi sinh vật gây bệnh, bảo vệ biểu mô và tăng khả năng miễn dịch của vật chủ. Đặc tính này làm tăng khả năng cạnh tranh của các chủng probiotic với các vi sinh vật bất lợi khác.

  • Hoạt tính kháng khuẩn chống lại các vi khuẩn gây bệnh: Lựa chọn được các chủng có khả năng sản sinh các chất kháng khuẩn là đặc tính quan trọng nhất trong phát triển probiotic. Các chủng probiotic cần có hoạt tính ức chế vi khuẩn gây bệnh như E. coli, Salmonella và Campylobacteria. Hoạt tính kháng khuẩn của chúng có thể theo nhiều cơ chế khác nhau như:

+ Sản sinh ra các chất Bacteriocin.

+ Làm giảm độ pH bởi tạo ra axit lactic.

+ Tạo ra H2O2.

+ Làm giảm độc tố theo các cơ chế khác nhau.

+ Khả năng làm giảm sự bám dính của các vi khuẩn gây bệnh trên bề mặt.

+ Cạnh tranh dinh dưỡng với các vi khuẩn gây bệnh.



  • Khả năng tồn tại trong môi trường axit dạ dày: Khoang miệng và dạ dày của vật chủ là nơi có môi trường axit pH từ 2-3 và có mặt các enzym tiêu hoá (amylaza, proteaza, lysozym…). Các chủng vi sinh vật được coi như là nguồn probiotic phải tồn tại được trong điều kiện này. Hiện nay các công ty đã khuyến cáo dùng vỏ bọc (microcapsute) với chế phẩm probiotic nhằm tăng khả năng sống của vi khuẩn probiotic khi đi qua khoang miệng và dạ dày.

  • Khả năng chịu muối mật: Thông thường, muối mật trong dịch tiêu hoá của động vật dao động 1-3% [48]. Để tồn tại và phát triển, các chủng probiotic phải có khả năng tồn tại và phát triển với nồng độ muối mật ≥ 2%, ngoài ra một số chủng probiotic (Nấm men, Bacillus và Lactobacillus) có khả năng sinh enzym tiêu hoá như: amylaza, xenlulaza và proteaza, lipaza và phytaza có vai trò làm tăng khả năng tiêu hoá thức ăn và hấp thu chất dinh dưỡng của vật chủ.

1.4.2. Các chủng vi sinh vật dùng phổ biến trong probiotic

  • Vi khuẩn lactic: gồm 2 chi vi khuẩn chủ yếu là LactobacillusBifidobacterium.

Các loài thuộc chi Lactobacillus: L. acidophilus, L. amylovorus, L. brevis, L. casei, L. casei subsp. rhamnosus (Lactobacillus GG), L. caucasicus, L. crispatus, L. delbrueckii subsp. bulgaricus (L. bulgaricus), L. fermentum (L. fermenti), L. gasseri, L. helveticus, L. johnsonii, L. lactis, L. leichmannii, L. paracasei, L. plantarum, L. reuteri, L. rhamnosus

Các loài thuộc chi Bifidobacterium: B. adolescentis, B. bifidum, B. breve, B. infantis, B. lactis (B. animalis), B. licheniformis, B. longum



  • Một số vi sinh vật probiotic khác không phải vi khuẩn lactic LactobacillusBifidobacterium: Bacillus subtilis, Enterococcus faecium, Saccharomyces boulardii, Saccharomyces cerevisiae.

1.4.3. Công thức chế phẩm probiotic

Như đã trình bày ở phần 1.4.2 có 3 đối tượng chủ yếu cho nghiên cứu phát triển chế phẩm là vi khuẩn lactic, vi khuẩn Bacillus và nấm men. Vai trò cũng như cơ chế tác động của chúng lên vật chủ rất khác nhau [36], cụ thể có trong bảng sau:



Bảng 2: Tóm tắt cơ chế tác động chủ yếu của các chủng probiotic lên vật chủ

Vi khuẩn lactic

Vi khuẩn Bacillus

Nấm men

- Sinh bacteriocin

- Cạnh tranh vị trí bám.

- Sinh các peptit, kích thích hệ thống miễn dịch của vật chủ.

- Cạnh tranh dinh dưỡng và vị trí bám vào biểu mô.

- Sinh các axit hữu cơ, tăng hiệu quả hấp thu chất dinh dưỡng.


- Sinh enzym phân giải các cơ chất như tinh bột, xenluloza; kích thích tiêu hoá.


- Sinh axit hữu cơ, kích thích tiêu hoá

- Hấp thu chất độc và cạnh tranh dinh dưỡng, vị trí bám trên biểu mô với vi sinh vật gây bệnh.




Tuỳ thuộc vào từng loại sản phẩm mà có thành phần vi sinh vật khác nhau.

1.4.4. Yêu cầu an toàn đối với các chủng vi sinh vật probiotic

Việc nghiên cứu, phát triển chế phẩm probiotic và sử dụng trong chăn nuôi bắt đầu từ khâu nghiên cứu sản xuất và tiêu thụ, sử dụng trên đàn gia súc, gia cầm [9]. Như vậy các chủng vi sinh vật đã qua nhiều khâu tiếp xúc với con người, môi trường trước khi vào cơ thể động vật. Điều này cho thấy là yêu cầu an toàn đối với chủng vi sinh vật là vấn đề quan trọng nhất đối với vật nuôi, con người và môi trường. Đối với động vật cần có thời gian thử nghiệm từ 1-3 tháng, kiểm tra các chỉ tiêu tăng trọng, phản ứng cơ thể, theo dõi các bệnh tiêu hoá, bệnh nhiếm khuẩn và các phản ứng phụ. Ngoài ra cần có những thông số phân tích sinh hoá về máu và đánh giá chỉ số coliform trong phân. Đối với con người không cần thiết phải thử nghiệm như trên động vật nhưng cần chú ý các phản ứng phụ như dị ứng với da, mũi, mắt (Arturo et al, 2006). Với môi trường cần đảm bảo là vi sinh vật không có hại đối với con người và động vật, không mang gen lạ. Nói chung các chủng vi sinh vật probiotic có nguồn gốc tự nhiên (từ hệ vi sinh vật đường ruột vật nuôi) là các chủng được khuyến cáo sử dụng. Tổ chức FAO (2002) đưa ra hướng dẫn với việc tuyển chọn các chủng probiotic, ngoài các đặc tính probiotic và đảm bảo an toàn thì các chủng này phải được cụ thể hoá các thông tin về nguồn gốc chủng, tên phân loại đến chi và loài. Đối với vấn đề an toàn probiotic, cộng đồng Châu Âu đã lập một Uỷ ban khoa học về dinh dưỡng động vật (SCAN: scientific committee for animal nutrition) đưa ra những quy định đánh giá an toàn đối với sản phẩm và những khuyến cáo cho vấn đề này qua các điều luật và kỹ thuật online ((SCAN, 2000).

Tổ chức FAO (2002) khuyến cáo các chủng probiotic không những cần được phân loại chính xác mà còn phải được cung cấp và lưu giữ tại các bảo tàng vi sinh vật đạt tiêu chuẩn quốc tế. Quy trình sản xuất phải theo tiêu chuẩn GMP (Good Manufacturing Practices).

1.4.5. Phân loại vi sinh vật

Yêu cầu tiên quyết là các chủng vi sinh vật probiotic phải được định danh chính xác đến chi (genus) và loài (species) (FAO, 2002). Hiện nay, trên thị trường có nhiều loại KIT định danh vi sinh vật khác nhau như API 50CH, API-20E... Tuy nhiên các KIT này được phát triển dựa trên các đặc tính sinh lý và sinh hoá của các vi sinh vật đã biết, vì vậy với yêu cầu định danh chính xác cần kết hợp các đặc tính phân loại về hình thái, sinh lý sinh hoá và sinh học phân tử. Phương pháp định danh dựa theo sinh học phân tử hiện nay chủ yếu vẫn là dựa theo kỹ thuật giải trình tự đoạn gen mã hoá cho ARN riboxom 16S (đối với vi khuẩn) và đoạn D1D2 của gen mã hoá cho ARN riboxom 28S hoặc vùng ITS (đối với nấm men). Trong những điều kiện cho phép thì người ta tiến hành kỹ thuật lai ADN với các chủng chuẩn để khẳng định vị trí phân loại của chủng nghiên cứu tới loài.

1.5. Tình hình nghiên cứu và sử dụng probiotic trên thế giới và Việt nam

1.5.1. Tình hình nghiên cứu sản xuất và sử dụng các chế phẩm probiotic trên thế giới

Việc sử dụng thực phẩm có probiotic (hoặc như 1 thành phần tự nhiên của thực phẩm hoặc thực phẩm đã lên men) đã được biết đến từ lâu, nhưng việc nghiên cứu hệ vi sinh vật đường ruột và sử dụng probiotic mới thực sự phát triển từ những năm 80 của thể kỷ 20 (Patterson và ctv, 2003). Những nghiên cứu phân loại và đặc điểm của quần thể vi sinh vật đường ruột ở người và động vật được tiến hành bởi Savage (1987); Vahjen và ctv (1998); Apajalahti và ctv (1998); Vander Wielen và ctv (2000) đã cho thấy nếu như trong ruột non của người BacteroidesBifidobacterium chiếm ưu thế thì ở gà là RuminococcusStreptococcus. Bằng kỹ thuật phân tử, các nhà nghiên cứu đã chỉ ra rằng chỉ có khoảng 20 đến 50% số loài vi sinh vật đường ruột ở động vật được phân lập, nuôi cấy như nguồn probiotic (Patterson và ctv, 2003). Apajialahti và ctv (1998); Netherwood và ctv (1999); Gong và ctv (2002); Zhu và ctv (2002) đã sử dụng kỹ thuật phân tử để nghiên cứu sự thay đổi cấu trúc quần thể và đặc điểm sinh học của hệ vi sinh vật đường ruột ở động vật dưới tác động của probiotic. Tuy nhiên, cho đến nay những nhân tố nào góp phần tạo nên 1 hệ vi sinh vật cân bằng hoặc làm rối loạn sự cân bằng của hệ vi sinh vật đường ruột cũng chưa được hiểu biết đầy đủ (Patterson và ctv, 2003). Đã có rất nhiều nghiên cứu về vai trò của probiotic đối với đời sống động vật như tác động của probiotic đối với hệ thống miễn dịch ở niêm mạc ruột (Schat và Myer, 1991; Hersbberg và Mayer, 2000); đối với sự thay đổi của niêm mạc ruột non ở vật nuôi (Glick, 1995; Fontaine và ctv, 1996; Dai và ctv, 2000; McCracken và Lorenz, 2001).

Những ảnh hưởng có lợi của probiotic thể hiện ở nhiều khía cạnh khác nhau nhưng những hiểu biết của con người về cơ chế tác động của probiotic còn rất hạn chế. Có một số tác giả cho rằng hiệu quả của probiotic trong việc ức chế sự phát triển của các vi khuẩn gây bệnh trong đường tiêu hóa của động vật có ý nghĩa rất quan trọng. Sự kìm hãm được thực hiện theo những cách sau: cạnh tranh chất dinh dưỡng, sản xuất độc tố và các sản phẩm trao đổi (các axit béo bay hơi, các chất giống kháng sinh...), cạnh tranh vị trí bám dính ở niêm mạc ruột và kích thích hệ thống miễn dịch ruột (Fuller, 1989; Gibson và Fuller, 2000; Rolfe, 2000; S.C. Knight và cs, 2009).

Trong khoảng 20 năm trở lại đây, nhờ ứng dụng những tiến bộ kỹ thuật trong lĩnh vực sinh học phân tử, đặc biệt là kỹ thuật giải trình tự axit nucleic trong nghiên cứu phân loại và định danh các chủng vi sinh vật, công nghệ sản xuất các sản phẩm probiotic phục vụ chăn nuôi ngày càng trở nên dễ dàng và phổ biến hơn ở nhiều nước trên thế giới. Tuy nhiên, các kết quả nghiên cứu về sử dụng các sản phẩm probiotic trong chăn nuôi rất khác nhau, đôi khi trái ngược nhau. Nhiều nghiên cứu bổ sung chế phẩm probiotic trên lợn và gà cho thấy có đáp ứng tích cực (Henrich và ctv, 2006): tăng cường khả năng miễn dịch ở lợn con; tăng tỷ lệ tiêu hóa các chất dinh dưỡng; tăng hiệu quả sử dụng thức ăn...). Bên cạnh đó cũng có nhiều nghiên cứu đã chứng tỏ hiệu quả không rõ rệt của việc bổ sung các chế phẩm probiotic trên lợn (Breston và ctv, 1995): không quan sát thấy ảnh hưởng tích cực của probiotic (Lactobacillus) bổ sung trong khẩu phần cho lợn cái và đực thiến ở giai đoạn lợn choai và vỗ béo; Navas-Sanchez và ctv (1995): khuyến cáo rằng đối với lợn con sau cai sữa không nên sử dụng các chế phẩm probiotic; Galassi và ctv (2001): không thấy có sự khác nhau về tỷ lệ tiêu hóa thức ăn và hiệu quả sử dụng năng lượng ở các nhóm lợn thí nghiệm và đối chứng được ăn thức ăn có và không có bổ sung probiotic...

Có rất nhiều ý kiến khác nhau khi giải thích sự khác biệt của các kết quả nghiên cứu, nhưng ý kiến được nhiều nhà khoa học thống nhất là các chế phẩm probiotic tạo nên các đáp ứng tích cực ở gia súc và gia cầm chỉ khi nó có đầy đủ các đặc tính probiotic, sự thiếu một hoặc nhiều các đặc tính của probiotic có thể là nguyên nhân chủ yếu của các đáp ứng âm tính.

1.5.2. Tình hình nghiên cứu sản xuất và sử dụng các chế phẩm probiotic ở Việt nam

Ở nước ta hiện nay, việc nghiên cứu sản xuất probiotic phục vụ cho đời sống dân sinh nói chung và chăn nuôi nói riêng còn rất mới mẻ và bắt đầu được quan tâm trong khoảng một thập kỷ gần đây. Lê Thanh Bình và ctv (1999) đã sản xuất chế phẩm PRO99 gồm hai chủng vi khuẩn lactic và nuôi thử nghiệm trên gà Broiler cho thấy quần thể vi sinh vật đường ruột thay đổi theo chiều hướng tích cực, các vi khuẩn lactic tăng, E.coli giảm rõ rệt ở nhóm gà được ăn thức ăn có thức ăn bổ sung PRO99. Khối lượng cơ thể lúc 50 ngày tuổi của gà ở nhóm được ăn thức ăn có bổ sung PRO99 cao hơn so với đối chứng 10,6%. Phạm Ngọc Lan và ctv (2003) đã phân lập được hai trong số 789 chủng vi khuẩn lactic trong ruột gà. Bằng các phương pháp nghiên cứu sinh học phân tử, nhóm tác giả đã xác định được các chủng CH123 và CH156 có những tính chất probiotic gần với Lactobacillus agillis Lactobacillus salivarius (có khả năng đề kháng được với 40% axit mật; sinh trưởng được ở môi trường pH = 4,0 và nồng độ NaCl = 6%, có hoạt tính kháng với Salmonella, E.coli) có khả năng sử dụng như nguồn probiotic ứng dụng trong chăn nuôi. Nguyễn Thị Hồng Hà và ctv (2003) đã sử dụng hai chủng Bifidobacterium bifidumLactobacillus acidophilus để sản xuất chế phẩm probiotic, bước đầu đã nghiên cứu được công nghệ sản xuất bằng phương pháp sấy phun. Chế phẩm sau 6 tháng vẫn có số tế bào vi khuẩn sống ở mức 106 CFU/g và có khả năng ức chế vi khuẩn Salmonella. Nguyễn Thùy Châu (2003) thông báo đã lựa chọn được chủng nấm men Candida ultilis CM 125 cho sinh khối cao trên môi trường rỉ mật, bước đầu đã đưa ra quy trình công nghệ sản xuất sinh khối loại nấm men này. Nguyễn La Anh và ctv (2003) đã phân lập được chủng vi khuẩn lactic BC 5.1 từ nước bắp cải muối chua và đã xác định được rằng chủng vi khuẩn này có tính chất probiotic và có thể sử dụng trong chế biến thực phẩm Biochie dạng dung dịch (từ vi khuẩn Bacillus Lactobacillus) với mật độ 108 CFU/ml có tác dụng cải thiện môi trường nước nuôi tôm, cá. Lê Tấn Hưng, Võ Thị Hồng Hạnh và ctv (2003) đã nghiên cứu sản xuất hai chế phẩm probiotic BIO I và BIO II. Chế phẩm BIO II gồm các nhóm vi khuẩn Lactobacillus, Bacillus và nấm men Sacharomyces phối hợp với các enzym -amylaza và proteaza dùng trong xử lý môi trường nước nuôi tôm, cá và chế phẩm BIO I dùng trong chăn nuôi. Hiện nay chế phẩm BIO II đã được ứng dụng rộng rãi nhưng chế phẩm BIO I hiệu quả sử dụng chưa cao.

Sau đây là thông tin một số sản phẩm probiotic có mặt trên thị trường:

Bảng 3: Tóm tắt một số thông tin của một vài sản phẩm probiotic có mặt trên thị trường


Sản phẩm


Nước sản xuất

Vi sinh vật sử dụng và mật độ (CFU/g)

Vi khuẩn Lactic

Bacillus

Nấm men

BioGuard

Việt Nam

107







E.lac

Hàn Quốc

2 x 107




4 x 107

BioSix

Việt Nam




105

105

Lactacids

Việt Nam

107







Adepro

Việt Nam

107







Lactizym

Việt Nam




6 x 105




Ferment

Trung Quốc




109




Lacto-Sacc

Mỹ

2,5 x 108




4,6 x 106

Chương 2: NGUYÊN LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU

2.1. Nguyên liệu

2.1.1. Nguồn vi sinh vật

- Phân lập và tuyển chọn các chủng vi sinh vật hữu ích từ các nguồn khác nhau: chất chứa trong đường tiêu hóa của lợn, gà; các nguồn khác nhau trong tự nhiên (đất, các thực phẩm lên men…)

- Các vi sinh vật kiểm định: E.coli, Shigella sp., Salmonella sp… từ Bảo tàng giống Vi sinh vật (VTCC) - Viện Vi sinh vật và Công nghệ Sinh học- Đại học Quốc gia Hà Nội

2.1.2. Hóa chất và thiết bị sử dụng

2.1.2.1. Hóa chất

Glucoza; MgSO4.7H2O; NaCl; K2HPO4; CaCO3; FeCl3.6H2O; Pepton; cao nấm men; cao malt; Tween 80; cao thịt; KI; I2 và các hóa chất khác của hãng Merck, Sigma…



2.1.2.2. Máy móc và dụng cụ

Các máy móc, dụng cụ được sử dụng có tại Bảo tàng giống chuẩn Vi sinh vật (VTCC) – Viện Vi Vinh Vật – Đại học Quốc gia Hà Nội. Bao gồm:

Kính hiển vi quang học (Olympus, Nhật Bản)

Nồi lên men (Hanil R&D- Hàn Quốc)

Máy sấy phun (Changzou SPD-5, Trung quốc)

Máy ly tâm lạnh C30P (Sigma, Đức)

Máy điện di ADN, máy phát hiện ADN trên gel (Biorad, Mỹ)

Máy đo pH (Horiba, Nhật Bản)

Máy lắc ổn nhiệt (Metler, Thụy Sĩ)

Máy PCR Mastercycler gradient (Eppendorf, Đức)

Máy đo quang phổ Ultrospec 3000 pro (Anh)

Tủ cấy vô trùng (Nuaire, Mỹ)

Cân điện tử (Precisa, Thụy Sĩ)

2.1.3. Môi trường nghiên cứu



2.1.3.1. Môi trường MRS (g/l):

Đường glucoza

20,0

K2HPO4

2,0

CaCO3

5,0

CH3COONa

5,0

Cao thịt

10,0

Triamoni xitrat

2,0

Pepton

10,0

MgSO4.7H2O

0,58

Cao nấm men

5,0

MnSO4.4H2O

0,28

Tween 80

1 ml

Nước cất vừa đủ

1000 ml

pH= 7,0; khử trùng ở 121oC/15 phút

Thạch

15,0

Môi trường dịch thể bỏ thạch và CaCO3

2.1.3.2. Môi trường LB (g/l):

Bacto-Tryptone

10

NaCl

10

Cao nấm men

5

Nước cất vừa đủ

1000 ml

pH= 7,0; khử trùng ở 121oC/15 phút







2.1.3.3. Môi trường thạch thường (g/l):

Thạch 15,0 NaCl 1,0

Pepton 5,0 Nước cất vừa đủ 1000ml

Cao thịt 2,0

pH= 7,0; khử trùng ở 121oC/15 phút

2.1.3.4. Môi trường YM (g/l):

Glucoza

10,0

Cao nấm men

3,0

Pepton

5,0

Thạch

15,0

Cao malt

3,0

Nước cất vừa đủ

1000 ml

pH= 7,0; khử trùng ở 121oC/15 phút

2.1.3.5. Môi trường Mueller Hinton (g/l):

Cao thịt

2,0

Tinh bột

1,5

Axit casein Hydrolysate

17,5

Thạch

15,0

Nước cất vừa đủ

1000 ml







pH= 7,3; khử trùng ở 121oC/15 phút

2.2. Phương pháp nghiên cứu

2.2.1. Các phương pháp định tính và định lượng



2.2.1.1. Định tính axit lactic

Đánh giá khả năng sinh axit của các chủng vi sinh vật bằng phương pháp đục lỗ. Phương pháp như sau: lấy phần dịch nuôi cấy các chủng phân lập được ly tâm lạnh 12000 vòng/phút lấy dịch trong. Nhỏ phần dịch trong vào các giếng trên đĩa thạch đã có CaCO3, để ở nhiệt độ phòng trong 24 giờ. Khả năng sinh axit của các chủng vi khuẩn được tính đánh giá thông qua đường kính vòng trong phân giải CaCO3.

∆D = D-d (mm) với D: đường kính vòng trong phân giải CaCO3 (mm).

d: đường kính lỗ thạch (mm).



2.2.1.2. Định lượng axit lactic theo Therner [61]:

Nguyên tắc: Dựa vào phản ứng hấp phụ màu của dịch axit lactic mà vi khuẩn sinh ra với phenolphtalein. Ta xác định được hàm lượng axit lactic của mẫu.

Tiến hành: Lấy 10ml dịch lên men đã li tâm bỏ sinh khối, bổ sung 20ml nước cất và thêm 2 giọt phenolphtalein (nồng độ 1% trong cồn 900). Sau đó chuẩn độ bằng NaOH 0,1N đến khi xuất hiện màu hồng nhạt bền trong 30 giây thì dừng lại. Ghi lại thể tích NaOH (ml) đã dùng. Độ axit được tính như sau:

% axit lactic = VNaOHtiêu tốn x 0,009 (g/l)



2.2.1.3. Xác định hoạt tính kháng khuẩn

Hoạt tính kháng khuẩn được xác định bằng phương pháp đục lỗ. Phương pháp như sau: môi trường thử hoạt tính kháng khuẩn được đổ trên đĩa Petri (đã chứa vi khuẩn kiểm định), sau khi môi trường đã đông cứng tiến hành đục lỗ thạch. Nhỏ phần dịch trong (dịch nuôi cấy đã li tâm) vào các lỗ đã đục, để ở 40C trong 6 giờ, sau đó mang các đĩa thạch để 370C. Sau 24 giờ quan sát vòng kháng khuẩn tạo thành. Hoạt tính kháng khuẩn của các chủng vi sinh vật tuyển chọn được tính bằng đường kính vòng kháng khuẩn ∆D.

∆D = D-d (mm) với D: đường kính vòng vô khuẩn (mm).

d: đường kính lỗ thạch (mm).



Khả năng sinh bacteriocin: dịch trong thu được sau li tâm được trung hòa bằng NaOH 0,1N (mục đích trung hòa axit tạo thành), sau đó làm tiếp tục các bước như trên để xác định hoạt tính kháng khuẩn của các chủng vi khuẩn lactic được tuyển chọn.

2.2.1.4. Xác định hoạt tính enzym

Hoạt tính enzym được xác định bằng phương pháp đục lỗ. Phương pháp như sau: Bản thạch thử hoạt tính enzym (cơ chất tinh bột, xenluloza) được đổ trên đĩa Petri, sau khi môi trường đã đông cứng tiến hành đục lỗ thạch. Nhỏ dịch enzym vào các lỗ đã đục, để ở 370C trong 24 giờ, sau đó nhuộm bằng thuốc thử Lugol để vòng phân giải cơ chất hiện rõ. Đo vòng phân giải D-d (mm), D là đường kính vòng ngoài, d là đường kính lỗ nhỏ dịch.

2.2.2. Phương pháp phân lập

2.2.2.1.Vi khuẩn lactic

Để phân lập vi khuẩn lactic từ các mẫu chất chứa trong đường tiêu hóa, các nguồn khác nhau trong tự nhiên, sử dụng phương pháp pha loãng mẫu bằng nước vô trùng, cấy gạt dịch pha loãng ở nồng độ 10-3 và 10-5 trên đĩa Petri chứa môi trường MRS, sau đó phủ tiếp 1 lớp thạch mỏng để tạo điều kiện kị khí. Nuôi ở 370C trong 48 giờ. Kiểm tra sự xuất hiện các khuẩn lạc trên đĩa Petri, tách và thuần khiết các khuẩn lạc có vùng trong suốt xung quanh (axit phân giải CaCO3 tạo vòng trong). Bảo quản giống trong ống nghiệm môi trường MRS thạch nghiêng. Mỗi mẫu phân lập chọn các khuẩn lạc có hình thái khác nhau và quan sát tế bào dưới kính hiển vi.



2.2.2.2. Vi khuẩn Bacillus

Mẫu trước khi pha loãng ở nồng độ tương tự như phân lập vi khuẩn lactic được xử lý ở nhiệt độ 800C/30 phút, sau khi pha loãng, dịch mẫu được gạt trên đĩa Petri chứa môi trường thạch thường. Nuôi ở 370C trong 48 giờ. Tách và thuần khiết các khuẩn lạc tạo thành.



2.2.2.3. Nấm men

Phương pháp làm tương tự như trên, nhưng thay bằng môi trường YM có bổ sung kháng sinh cloramphenicol. Nuôi cấy các đĩa Petri đã gạt mẫu ở 300C. Sau 48 giờ chọn các khuẩn lạc tạo thành và soi dưới kính hiển vi quang học.

2.2.3. Phương pháp tuyển chọn

2.2.3.1. Vi khuẩn lactic

Sau khi thuần khiết các chủng vi khuẩn lactic phân lập được, tiến hành tuyển chọn các chủng có khả năng sinh axit lactic cao (định tính) và khả năng sinh bacteriocin kháng vi khuẩn kiểm định.



2.2.3.2. Vi khuẩn Bacillus

Sau khi thuần khiết các chủng vi khuẩn phân lập được, tiến hành tuyển chọn các chủng có khả năng sinh enzym amylaza và xenlulaza cao và khả năng kháng vi khuẩn kiểm định.



2.2.3.3. Nấm men

Tuyển chọn các chủng nấm men phân lập được thông qua đánh giá khả năng kháng các vi khuẩn kiểm định.


2.2.4. Phương pháp phân loại

2.2.4.1. Phân loại vi khuẩn

  • Phương pháp sinh lý, sinh hóa

Nhuộm gram

Nguyên tắc: Nhuộm Gram (phản ứng Gram) có vai trò đặc biệt trong việc phân loại vi khuẩn. Trong quá trình nhuộm Gram, tế bào bước đầu được xử lý với tím kết tinh và iot nên có sự tạo thành phức chất tím kết tinh iot bên trong tế bào. Khi vi khuẩn Gram âm bị tẩy cồn, lipit của lớp màng ngoài bị hoà tan làm tăng tính thấm của màng dẫn đến sự rửa trôi phức chất tím – iot và làm cho vi khuẩn mất màu. Khi nhuộm bổ sung chúng sẽ bắt màu với thuốc này (Đỏ vàng với Safranin hay đỏ tía với Fuchsin). Ở vi khuẩn Gram dương, cồn làm cho các lỗ trong peptidoglycan co lại do đó phức chất tím – iot bị giữ lại bên trong tế bào.

Tiến hành: Dùng que cấy vô trùng lấy dịch huyền phù tế bào vi khuẩn đặt lên phiến kính. Cố định tiêu bản bằng ngọn lửa rồi nhuộm thuốc đầu bằng dung dịch tím kết tinh (crystal violet) trong khoảng 1 phút. Rửa bằng nước. Nhuộm tiếp bằng dung dịch Lugol trong 1 phút. Rửa bằng nước. Phủ lên vết bôi dung dịch etanol 95% : axeton (1:1) trong khoảng 1 phút. Lại rửa bằng nước. Sau đó nhuộm tiếp bằng thuốc nhuộm màu đỏ (như Safranin hay Fuchsin Ziehl) trong 30 giây - Rửa qua nước, để khô, soi kính.

Xác định khả năng đồng hóa các loại đường

1% các loại đường sử dụng thay cho glucoza trong môi trường MRS (vi khuẩn lactic), LB (vi khuẩn Bacillus): L-arabinoza, D-riboza, D-Xyloza, D-fructoza, D-mannoza, D-mannitol, D-sorbitol, lactoza, trehaloza, raffinoza, Na-gluconat.

Môi trường được chia vào các ống nhỏ. Cấy vi sinh vật, để 2 -3 ngày.

Đối chứng dương được cấy trên môi trường chứa glucoza, đối chứng âm được cấy trên các môi trường không chứa nguồn đường nào.



Thử khả năng lên men nguồn đường glucoza (chỉ với vi khuẩn lactic)

Nguyên tắc: Việc phát triển trên môi trường với các hợp chất này có thể làm dẫn đến việc tích luỹ các axit hữu cơ, các sản phẩm trung hoà, các loại khí.

Cách tiến hành: Sử dụng môi trường dịch thể (Glucoza - 2%). Cho vào mỗi ống nghiệm 2ml môi trường cơ sở và 1 ống Durham để ngược. Khử trùng ở 121oC/15 phút. Bổ sung 100l dịch vi khuẩn vào mỗi ống, nuôi cấy trong 1-2 ngày. Quan sát khả năng sinh khí CO2, nếu sinh khí là lên men dị hình và ngược lại là lên men đồng hình.

Phản ứng catalaza (chỉ với vi khuẩn lactic)

Phần lớn các chủng vi khuẩn lactic có phản ứng catalaza âm tính nhưng đặc biệt có một số loài thuộc chi Pedioccocus lại có phản ứng catalaza dương tính gọi là “Catalaza giả” như P. pentosaceus do chúng không nhảy cảm với cyanide và azide và không chứa một nhóm giả của Haem (C34H3204N2Fe).



Tiến hành: Nhỏ trực tiếp vài giọt H2O2 3% lên bề mặt khuẩn lạc vi khuẩn, quan sát sự xuất hiện bọt khí bằng mắt thường.

  • Phương pháp sinh học phân tử

Xác định trình tự rARN 16S của các chủng vi khuẩn theo phương pháp của Sakiyama và cs (2009).

Tách chiết ADN

- Ly tâm 1.5ml dịch nuôi vi khuẩn lấy sinh khối tế bào.

- Hoà sinh khối tế bào trong 100 l TE ( TE buffer: 15 mM Tris-HCl +1 mM EDTA (pH 7,5)).

- Thêm 0,4 mg lysozym. Trộn đều, ủ 370C/1 giờ. Trộn đều 3 phút.

- Thêm 100 l SDS 10% (w/v), trộn đều 2-3 phút trộn thật kỹ, ủ 370C/30 phút.

- Thêm một thể tích tương đương phenol: chloroform: isoamyl alcohol (PCI), trộn đều. Ly tâm 15000v/p, 15phút. Chuyển lớp dịch phía trên sang ống eppendoft khác.

- Thêm 8 l ARNaza 3 mg/ml, trộn đều, ủ ở 37oC trong 30 phút.

- Thêm 12 l proteinaza K (5 mg/ml), trộn đều, ủ 15 phút ở 560C.

- Thêm một thể tích tương đương phenol: chloroform: isoamyl alcohol (PCI), trộn đều. Ly tâm 15000v/p, 15phút. Chuyển lớp dịch phía trên sang ống eppendoft khác.

- Thêm 1 thể tích tương đương chloroform: isoamyl alcohol, trộn đều, ly tâm 15000v/p, 15phút. Chuyển lớp dịch phía trên sang ống eppendoft khác.

- Thêm 1/ 10 V Natri axetat 3M và 1ml Etanol 100%, đảo trộn. Đặt trong đá 30 phút. Ly tâm 15000v/p trong 15 phút. Bỏ lớp dịch trên.

- Rửa tủa bằng Etanol 70%.

- Làm khô ADN bằng máy cô quay chân không.

- Hoà tan ADN trong 50-100l nước hoặc TE.

- Kiểm tra các sản phẩm của PCR bằng điện di:

Đun tan 1% agaroza (dung dịch 50X TAE: 2ml, nước cất: 98 ml, agaroza: 1g) để ấm, đổ vào khuôn, đợi cho nguội và đặt tấm gel vào trong máy điện di, ngập trong 300ml dung dịch 1 X TAE. Trộn 2 l dung dịch 6X loading buffer với 5 l mẫu trộn đều, nhỏ vào giếng. Chạy điện di bằng dòng điện một chiều với điện thế 100V, cưòng độ dòng điện 80 mA trong 30 phút, bỏ ra ngâm trong dung dịch EtBr (nồng độ 0,5 l/ml) 20 phút vớt ra. Quan sát trên máy soi gel



Phản ứng khuếch đại ADN.

Thành phần phản ứng:

Thành phần

Thể tích (l)

10X buffer

10

MgCl2

8

dNTP 2.0 mM

10

Primer xuôi (10 pmol/l)

2

Primer ngược (10 pmol/l)

2

Taq polymerase

2

Template

1-2

H2O

cho đủ 100

Chu trình nhiệt:

950C - 3 phút

950C - 30giây

560C - 15 giây 30 chu kỳ

720C - 1 phút

720C - 5 phút

40C - 



Primer:

Primer xuôi : 27F 5'-AGAGTTTGATCCTGGCTCAG-3'.

Primer ngược: 1525R 5'-AAAGGAGGTGATCCAGCC-3'

- Kiểm tra các sản phẩm của PCR bằng điện di

Đun tan 1% agaroza (dung dịch 50X TAE: 2ml, nước cất: 98 ml, agaroza: 1g) để ấm, đổ vào khuôn, đợi cho nguội và đặt tấm gel vào trong máy điện di, ngập trong 300ml dung dịch 1 X TAE. Trộn 2 l dung dịch 6X loading buffer với 5 l mẫu trộn đều, nhỏ vào giếng. Chạy điện di bằng dòng điện một chiều với điện thế 100V, cưòng độ dòng điện 80 mA trong 30 phút, bỏ ra ngâm trong dung dịch EtBr (nồng độ 0,5 l/ml) 20 phút vớt ra. Quan sát trên máy soi gel

Tinh sạch sản phẩm PCR.

- Sử dụng bộ kit QIA gen theo chỉ dẫn của nhà sản xuất.

+ Thêm dung dịch PBI vào mẫu theo thể tích 5:1. Trộn đều.

+ Cho hỗn hợp mẫu vào cột, ly tâm 10.000 v/p trong 1 phút .

+ Đổ bỏ dịch phía dưới cột.

+ Bổ sung 750 l PE buffer lên cột. Ly tâm 10.000 v/p trong 1 phút

+ Đổ bỏ dịch dưới cột

+ Ly tâm tiếp 10.000 v/p trong 1 phút

+ Chuyển cột sang ống eppendoft mới

+ Thêm 30l nước. Để ở nhiệt độ phòng 5 phút

+ Ly tâm 10.000 v/p trong 1 phút

+ Lấy dịch phía dưới.

- Kiểm tra độ tinh sạch của mẫu:

Mẫu được kiểm tra trên máy quang phổ ở các bước sóng 260 và 280. Tính tỷ lệ tinh sạch: OD260/OD280 > 1,7



Phản ứng khuếch đại ADN cho sequence:

- Terminator Ready Reaction Mix (Termix):

Buffer 5X 9l

Bigdye Ready Reaction premix 18l

H2O 9l

- Thành phần phản ứng PCR cho sequence:

Termix 8l

Primer (*) 1l

Template 1l ( nồng độ ADN là 40-60 g/ml)

H2O 10l

(*) Các loại primer đã sử dụng:

27F: 5'-AGAGTTTGATCCTGGCTCAG-3'.

1525R: 5'-AAAGGAGGTGATCCAGCC-3'.

780F: 5'- GAATTGATACCCTGGTAG-3.'

350R: 5'- CTGCTGCCTCCCGTAG-3'.

1100F: 5'- GCAACGAGCGCAACCC-3'.

920R: 5'- GTCAATTCCTTTGAGTTT-3'.

- Chu trình nhiệt cho phản ứng khuếch đại gen:

960C-1phút

960C - 10giây

500C - 5 giây 25 chu kỳ

600C - 4 phút



Tinh sạch sản phẩm RCR cho sequence.

- Chuyển 20l sản phẩm sang ống eppendoft sạch

- Thêm 5l EDTA 125mM và 60l Etanol 100%. Để khoảng 15 phút ở nhiệt độ phòng.

- Ly tâm 15.000v/p, 15phút

- Bỏ dịch, thêm 60l Etanol 70% để rửa, ly tâm 15000v/p, 10 phút

- Làm khô.

- Thêm 10l HiDi Formamide

- Để ở 960C trong 2 phút

- Cho ngay mẫu vào nước đá lạnh

- Chuyển toàn bộ mẫu vào giếng trong khay dùng cho sequence.

- Vận hành máy xác định trình tự gen ABI 3100 Avant

Đọc trình tự ADN.

Trình tự của rADN của các mẫu được đọc trực tiếp trên máy đọc trình tự tự động 3100 Avant. Sau đó kết quả trình tự được so sánh với các trật tự của các loài đã được xác định trong ngân hàng gen, để xác định đến tên loài.



2.2.4.2. Phân loại nấm men

  • Phương pháp sinh lý, sinh hóa

Xác định khả năng đồng hóa các loại đường

1% các loại đường sử dụng thay cho glucoza trong môi trường cơ sở (Bacto yeast nitrogen base 6,7g; Bacto yeast extract 50 mg; Bacto casamino acid 50 mg): L-arabinoza, D-riboza, D-Xyloza, D-fructoza, D-mannoza, D-mannitol, D-sorbitol, lactoza, trehaloza, raffinoza, Na-gluconat.

Môi trường được chia vào các ống nhỏ. Cấy vi sinh vật, sau 2 -3 ngày quan sát sự sinh trưởng của các chủng được tuyển chọn.

Đối chứng dương được cấy trên môi trường chứa glucoza, đối chứng âm được cấy trên các môi trường không chứa nguồn đường nào.



Thử khả năng lên men nguồn đường glucoza

Phân vào mỗi ống nghiệm 2 ml môi trường có thành phần như sau:

Cao nấm men 0,5%

Glucoza 2%

Cho vào mỗi ống 1 ống Durham để ngược, sau đó đem khử trùng ở 121oC trong 15 phút.

Cấy vào mỗi ống một vòng que cấy 1-2 ngày tuổi, quan sát sau 1 tuần nuôi cấy.



  • Phương pháp sinh học phân tử

Xác định trình tự rARN của chủng nghiên cứu theo phương pháp của Manitis và cộng sự [1982]. Bao gồm các bước:

Tách ADN cho phản ứng PCR

- Cho 100 l đệm lysis vào ống nhựa 1,5 ml. Lấy một vòng que cấy mẫu, trộn thật đều bằng máy vortex hoặc nghiền bằng dụng cụ chuyên.

- Đun hỗn hợp 100oC trong 15 phút. Thêm 100 l kaliaxetat, sau đó trộn đều và đặt trên đá 1 giờ.

- Ly tâm 15.000 vòng/phút trong 5 phút ở nhiệt độ 4oC, sau đó lấy phần nổi phía trên.

- Thêm 200 l CHCl3-Isoamyl alcohol và trộn đều, ly tâm 15.000 v/ph trong 15 phút, sau đó lấy phần nổi phía trên. Làm lại như vậy thêm một lần nữa.

- Thêm 200l 2-propanol (Iso-propanol) và đặt trong đá 20phút. Ly tâm 15.000 v/ph trong vòng 15 phút và lấy phần kết tủa.

- Rửa sạch phần tủa (pellet) bằng etanol 70%. Ly tâm 15.000 v/ph trong 10 phút và lấy tủa.

- Làm khô bằng máy cô quay chân không trong 3-5 phút.

- Hoà tan tủa trong TE (30-50 l), giữ trong tủ lạnh 4oC trong 1 ngày.

- Giữ ở -20oC trước khi sử dụng.



Phản ứng PCR

- Hỗn hợp phản ứng:

10X Buffer 10l

dNTP mixture 16l

Mồi xuôi 2l

Mồi ngược 2l

TaqTm 1.2 l

Mẫu ADN ( 50 ng) 1 l

Nước cất đến 100l

+ Mồi cho phản ứng PCR các vùng ITS (Internal transcribed spacer)

Mồi xuôi ITS1: 5’ – TCCGTAGGTGAACCTGCGG – 3’

Mồi ngược ITS4: 5’ – TCCTCCGCTTATTGATATGC – 3’

- Chu trình nhiệt cho phản ứng PCR


Bước tiến hành

Nhiệt độ (0C)

Thời gian

1

94

3 phút

2

lặp lại 30 lần chu kỳ sau







94

1 phút




52

1 phút 30 giây




72

2 phút 30 giây

3

72

7 phút

4

4

-

- Kiểm tra các sản phẩm của PCR bằng điện di

Đun tan 1% agaroza (dung dịch 50X TAE: 2ml, nước cất: 98 ml, agaroza: 1g) để ấm, đổ vào khuôn, đợi cho nguội và đặt tấm gel vào trong máy điện di, ngập trong 300ml dung dịch 1 X TAE. Trộn 2 l dung dịch 6X loading buffer với 5 l mẫu trộn đều, nhỏ vào giếng. Chạy điện di bằng dòng điện một chiều với điện thế 100V, cưòng độ dòng điện 80 mA trong 30 phút, bỏ ra ngâm trong dung dịch EtBr (nồng độ 0,5 l/ml) 20 phút vớt ra. Quan sát trên máy soi gel



Tinh sạch ADN sau khi thực hiện phản ứng PCR.

- Sử dụng bộ kit QIA (Invitrogen, Đức) thực hiện theo chỉ dẫn của nhà sản xuất.

+ Thêm dung dịch PB vào mẫu theo thể tích 3:1. Trộn đều, đưa vào cột, ly tâm 13.000 v/p trong 30 giây.

+ Đổ bỏ dịch phía dưới cột.

+ Bổ sung 500 l PE lên cột. Ly tâm 13.000 v/p trong 30 giây

+ Đổ bỏ dịch dưới cột

+ Ly tâm tiếp 13.000 v/p trong 2 phút

+ Chuyển cột sang ống eppendoft mới

+ Thêm 30l nước. Để ở nhiệt độ phòng 5 phút

+ Ly tâm 13.000 v/p trong 1 phút

+ Lấy dịch phía dưới.

- Kiểm tra độ tinh sạch của mẫu:

Mẫu được kiểm tra trên máy quang phổ khả kiến ở các bước sóng 260 và 280. Tính tỷ lệ tinh sạch: OD260/OD280 > 1,7

Phản ứng khuếch đại ADN cho sequencing.

Các sản phẩm PCR tinh sạch được khuếch đại với bộ kít ABI PRISM Cycle sequencing và đệm 5X sequence (Perkin-Elmer Applied Biosystem) với hỗn hợp phản ứng như sau :



Terminator Ready Reaction Mix

8 l

Mẫu ADN sau PCR

200 ng/ml

Mồi

1 l

Nước cất

đủ đến 20l

Mồi ITS1: 5’ – TCCGTAGGTGAACCTGCGG – 3’

Mồi ITS4: 5’ – TCCTCCGCTTATTGATATGC – 3’

- Chu trình nhiệt khuếch đại ADN cho sequencing:


Bước tiến hành

Nhiệt độ (0C)

Thời gian

1

96

1 phút

2

lặp lại 25 lần chu kỳ sau







96

10 giây




50

5 giây




60

4 phút

3

4

-

Sản phẩm lúc này là các đoạn ADN đơn được duỗi ra.

- Tinh sạch sản phẩm cho sequencing:

Mẫu được chuyển sang ống eppendoft 1,5 ml. Thêm 5l EDTA 1,25 M, thêm 60l ethanol 100%. Trộn thật nhẹ nhàng. Giữ ở nhiệt độ phòng trong 15 phút. Ly tâm 15.000 v/ph trong 15 phút. Đổ bỏ dịch phía trên. Rửa bằng 100l ethanol 70%. Ly tâm 15.000 v/ph trong 10 phút. Làm khô mẫu băng máy cô quay chân không trong 3-5 phút.

Đọc trình tự ADN.

Trình tự của ITS rARN của chủng nấm được đọc trực tiếp trên máy đọc trình tự tự động 3100 Avant. Sau đó kết quả trình tự được so sánh với các trật tự của các loài đã được xác định trong ngân hàng gen.



2.2.4. Nghiên cứu các điều kiện nuôi cấy thích hợp

2.2.4.1. Ảnh hưởng nhiệt độ lên sinh trưởng của các chủng vi sinh vật

Các chủng vi sinh vật được nuôi cấy trên môi trường dịch thể có pH = 7,0, trong máy lắc ổn nhiệt (220 vòng/phút) với các dải nhiệt độ khác nhau 30; 37; 40; 45oC.



2.2.4.2. Ảnh hưởng của pH môi trường lên sinh trưởng của các chủng vi sinh vật Tương tự như trên, các chủng vi sinh vật cũng được nuôi cấy trên môi trường dịch thể có độ pH khác nhau (2; 3,0; 4,0; 5,0; 6,0; 7,0), trên máy lắc ổn nhiệt giữ 37oC.

2.2.4.3. Ảnh hưởng của môi trường có nồng độ muối mật khác nhau đến sinh trưởng của các chủng vi sinh vật

Các chủng vi sinh vật probiotic được nuôi riêng rẽ trên môi trường dịch thể phù hợp cho từng vi sinh vật chứa nồng độ muối mật thay đổi (0,2; 0,5; 1; 2; 3; 4 và 5%) từ đó tìm giới hạn nồng độ muối mật không ảnh hưởng đến sinh trưởng của các chủng probiotic lựa chọn.

Sau 48 giờ, tốc độ sinh trưởng của các chủng vi sinh vật được đánh giá: với vi khuẩn (thông qua mật độ quang OD660); với nấm men (thông qua CFU/ml).

2.2.5. Phát triển chế phẩm



2.2.5.1. Đánh giá tính đối kháng của các chủng lựa chọn

Đánh giá tính đối kháng của các chủng thông qua phương pháp cấy vạch.



2.2.5.2. Đánh giá khả năng bám dính của các chủng vi sinh vật vào niêm mạc đường tiêu hóa

  • Chuẩn bị vi khuẩn và nấm men probiotic:

- Vi khuẩn và nấm men được thu tại giữa pha log từ môi trường dịch thể tương ứng bằng ly tâm (6000 vòng/phút/15 phút) sau đó rửa 2 lần với đệm PBS.

- Tế bào được huyền phù lại trong môi trường dịch thể (MRS cho vi khuẩn lactic, LB cho Bacillus, YM cho nấm men) trước khi tiến hành cho bám dính đạt mật độ 4 x 108 CFU/ml



Chuẩn bị vật liệu bám dính:

- Chuẩn bị các mẫu ruột tươi (ruột gà) có cùng kích thước sau đó rửa 3 lần với đệm PBS sao cho tất cả các vi khuẩn không còn trên bề mặt niêm mạc ruột nữa. Rửa lại 1 lần với môi trường dịch thể MRS (LB hoặc YM).



  • Tiến hành bám dính:

- Bổ sung dịch tế bào đã chuẩn bị ở trên vào vật liệu bám dính (2 thể tích tế bào/1 trọng lượng vật liệu), ủ tại 370C trong 90 phút.

- Rửa tế bào:

+ Rửa mẫu ruột sau khi ủ lần 1 với 2 thể tích muối sinh lý 1%.

+ Rửa 3 lần với 2 thể tích đệm PBS, thu lấy dịch rửa 3 lần, đếm tế số lượng tế bào bám dính trên mẫu.



2.2.5.3. Đánh giá tính tương thích của các chủng vi sinh vật với một số thành phần có hoạt tính trong khẩu phần ăn.

Các chủng nghiên cứu được nuôi cấy trên môi trường dịch thể tương ứng (MRS cho vi khuẩn lactic; thạch thường cho vi khuẩn Bacillus và YM cho nấm men) nhưng có bổ sung các thành phần có hoạt tính thường có trong các khẩu phần ăn cho lợn và gia cầm gồm các loại kháng sinh thương mại BMD (50 ppm); Saigon Nox (100 ppm), Colistine 98% (100 ppm), CTC 15% (100 ppm); một số loại khoáng CuSO4 (250 ppm Cu); ZnSO4 (100 ppm Zn) và hỗn hợp axit hữu cơ (gồm axit lactic axit, axit formic, axit citric...) với liều 200mg/lít. Nuôi cấy lắc (200 vòng/phút) trong tủ ấm (37oC). Đếm mật độ tế bào trên môi trường đĩa thạch sau 48h.



2.2.5.4. Phát triển chế phẩm probiotic

Các chủng vi sinh vật probiotic được sử dụng để phát triển chế phẩm dạng bột theo nghiên cứu trước đây (Trần Quốc Việt và cs, 2007).

- Hai chế phẩm probiotic dạng bột đa chủng gồm PBB1 và PBB2 được sử dụng cho thí nghiệm này. Mật độ các chủng vi sinh vật hữu ích đạt 107 – 108 cfu/g.

- Chín mươi sáu (96) lợn con lai thương phẩm cai sữa 21 ngày tuổi có khối lượng bình quân từ 7-8 kg đã được sử dụng. Lợn được nuôi trong thời gian 50 ngày, trong chuồng nền xi măng, thông thoáng tự nhiên.

- Khẩu phần cơ sở cho lợn thí nghiệm được phối chế từ các nguyên liệu: ngô ép đùn, tấm gạo tẻ, khô dầu đậu tương tách vỏ, bột thay thế sữa (milk replacer), bột sữa whey, premix vitamin-khoáng và các axit amin tổng hợp.


  • Phương pháp bố trí thí nghiệm.

- Lợn thí nghiệm được phân ngẫu nhiên vào 4 lô theo thể thức ngẫu nhiên hoàn toàn, mỗi lô 24 con được nuôi trong 3 ô chuồng, 8 con/ô (đồng đều tính biệt), mỗi ô là một lần lặp lại. Lợn ở các lô 1 (đối chứng âm) và 2 (đối chứng dương) được ăn khẩu phần cơ sở (bảng 2) không và có bổ sung colistin với liều 100g/tấn tương ứng. Lợn ở các lô 3 và 4 được ăn khẩu phần cơ sở có bổ sung probiotic (PBB1 và PBB2) với liều 2000 g/tấn.

Chương 3: KẾT QUẢ VÀ THẢO LUẬN

3.1. Phân lập các chủng vi sinh vật hữu ích.

Vi sinh vật probiotic chủ yếu là vi khuẩn lactic, Bacillus và nấm men Saccharomyces cerevisiae, Saccharomycess boulardii. Trên thực tế các đối tượng trên có mặt trong hầu hết các mẫu trong tự nhiên, để thu được chúng có thể phân lập từ nhiều nguồn khác nhau như thực phẩm lên men (rau, củ, nem chua, bún), đất nước, thực phẩm các loại, bánh men... Trong nghiên cứu này chúng tôi tập trung phân lập và tuyển chọn các chủng vi sinh vật tồn tại trong đường tiêu hoá của vật nuôi (gà, lợn) và một số nguồn khác nhau (đất, các sản phẩm lên men). Việc lấy mẫu phân lập sẽ có nhiều khả năng thu nhận và tuyển chọn được các chủng vi sinh vật có đặc tính probiotic như chịu axit, muối mật, sinh enzym thuỷ phân và bacteriocin kháng khuẩn gây bệnh.

Từ các nguồn khác nhau, 254 chủng vi sinh vật đã được phân lập, trong đó có 164 chủng vi khuẩn lactic, 45 chủng vi khuẩn Bacillus và 45 chủng nấm men (bảng 4).

Bảng 4: Kết quả phân lập các vi sinh vật từ các nguồn khác nhau


Nguồn phân lập

Nhóm vi sinh vật đã phân lập

Vi khuẩn lactic

Bacillus

Nấm men

Chất chứa trong ruột non và ruột già của lợn ngoại

48

20

18

Chất chứa trong ruột non và ruột già của lợn Móng cái

43

16

13

Chất chứa trong ruột non, ruột già của gà Lương Phượng

38

2

5

Chất chứa trong ruột non, ruột già của gà Ri

20

2

2

Các nguồn khác nhau trong tự nhiên

15

5

7

Tổng

164

45

45

Tổng số

254

Trong đó từ chất chứa trong ruột non, ruột già của lợn và gia cầm đã phân lập được 149 chủng vi khuẩn lactic, 40 chủng Bacillus và 38 chủng nấm men. Từ các nguồn khác nhau trong tự nhiên (đất, các sản phẩm lên men...), đã phân lập được 15 chủng vi khuẩn lactic, 5 chủng Bacillus và 7 chủng nấm men.

Các chủng vi sinh vật sau khi phân lập được giữ trong ống nghiệm môi trường (MRS, thạch thường và YM) thạch nghiêng để sử dụng cho các nghiên cứu tiếp theo. Đồng thời các chủng này còn được bảo quản lạnh sâu ở - 800 C nhằm giữ được giống trong thời gian dài.

3.2. Tuyển chọn các vi sinh vật có đặc tính probiotic

3.2.1. Vi khuẩn lactic.



3.2.1.1. Đánh giá khả năng sản sinh axit

164 chủng vi khuẩn lactic phân lập được được nuôi cấy lắc trên 20 ml môi trường MRS dịch thể trong 48 giờ. Thu dịch nuôi cấy, ly tâm lạnh 12000 vòng/phút lấy dịch trong. Để xác định khả năng sinh axit chúng tôi tiến hành đục thạch và nhỏ dịch vào các giếng trên đĩa thạch đã có CaCO3, để ở nhiệt độ phòng trong 24 giờ. Kết quả tuyển chọn khả năng sinh axit được trình bày ở bảng 5.



Bảng 5. Số lượng chủng vi khuẩn lactic có khả năng sinh axit

Khả năng sinh axit

Số lượng chủng

Tỷ lệ (%)

Cao (D-d ≥25mm)

30

18,3

Trung bình (10≤D-d<25mm)

89

54,3

Yếu (0

45

27,4

Tổng

164

100

(D-d là đường kính vòng phân giải CaCO3)

Kết quả thu được cho thấy khả năng sinh axit của vi khuẩn lactic khá đa dạng, số chủng sinh axit trung bình là 89 chủng chiếm nhiều nhất (54,3%), trong khi đó khả năng sinh axit mạnh có 30 chủng chiếm 18,3%, còn lại là 45 chủng (27,4%). Các chủng sinh axit với hàm lượng cao nhất được dùng trong các nghiên cứu tiếp theo.



3.2.1.2. Đánh giá khả năng sản sinh bacteriocin

Một trong những đặc tính quan trọng nhất làm căn cứ tuyển chọn các chủng vi khuẩn probiotic là khả năng kháng các vi khuẩn kiểm định. Trong số 30 chủng sản sinh axit lactic cao nhất, 12 chủng được xác định là có hoạt tính kháng khuẩn mạnh nhất. Kết quả được trình bày ở bảng 6.



Bảng 6: Khả năng sản sinh bacteriocin kháng vi khuẩn kiểm định của 12 chủng vi khuẩn lactic (được đánh giá bằng đường kính vòng kháng khuẩn - ∆D, mm)

STT

Ký hiệu chủng

Vi khuẩn kiểm định (∆D, mm*)

Salmonella entriristic

E. coli

Shigella flexneri

1

1K8

11

2

6

2

2M33

13

4

7,5

3

3K2

11

0

10

4

5M2

5

0

10,5

5

5H4

9

0

11

6

6H2

21

12

10

7

C3

16

11

10

8

Đ2

12

3

6

9

Đ12

6

1,5

3

10

Đ7

10

7

7

11

NC1

8

6

12

12

NC2

6

3

9

(* ∆D = D-d: đường kính vòng kháng khuẩn)

Kết quả ở bảng 6 cho thấy, cả 12 chủng đều có hoạt tính kháng vi khuẩn SalmonellaShigella. 09 chủng có khả năng ức chế cả 3 loại vi khuẩn kiểm định (Salmonella, E. coli Shigella). Tuy nhiên, mức độ kháng các vi khuẩn kiểm định của các chủng rất khác nhau. Vòng kháng khuẩn (cả 3 loại vi khuẩn kiểm định) có đường kính lớn thuộc về các chủng 6H2; C3 (D-d ≥10mm đối với cả 3 chủng kiểm định); vòng kháng khuẩn trung bình thấy ở chủng Đ2; Đ7; 1K8; NC1; NC2 và 2M33 (D-d ‹ 10mm). Có 3 chủng 3K2; 5M2 và 5H4 có hoạt tính kháng E. coli không rõ rệt (D-d = 0 mm) (Hình minh họa hoạt tính kháng khuẩn của một số chủng lactic có trong hình 4, 5 thuộc phụ lục 1).



Vì vậy 09 chủng sinh bacteriocin kháng cả 3 loại vi khuẩn kiểm định được dùng trong các nghiên cứu tiếp theo.

Hình 2: Sơ đồ minh họa hoạt tính kháng khuẩn của các chủng lactic.

3.2.2. Vi khuẩn Bacillus

3.2.2.1. Đánh giá khả năng sản sinh enzym

Tổng số 45 chủng vi khuẩn Bacillus phân lập được, đã được nuôi lắc trên 20ml môi trường LB dịch thể trong 48 giờ. Thu dịch nuôi cấy, ly tâm lạnh 10000 vòng/phút lấy dịch enzym. Để xác định khả năng phân giải cơ chất chúng tôi tiến hành đục thạch và nhỏ dịch vào các giếng trên đĩa thạch đã có cơ chất khác nhau (tinh bột, xenluloza), để ở nhiệt độ 370 C trong 24 giờ, sau đó nhuộm bằng thuốc thử Lugol và đo vòng phân giải. Kết quả được thể hiện ở bảng 7.



Bảng 7: Số lượng chủng Bacillus có khả năng sinh enzym ngoại bào phân giải cơ chất

Hoạt tính enzym

Số lượng chủng Bacillus có khả năng phân giải cơ chất

Tinh bột

Xenluloza

Mạnh (D-d ≥25mm)

7

6

Trung bình (8≤D-d<25mm)

23

5

Yếu (0

15

34

(D-d là đường kính vòng phân giải cơ chất)

Các chủng có hoạt tính enzym mạnh và trung bình (D-d ≥8mm) với cả 2 cơ chất (11 chủng) được dùng trong các nghiên cứu tiếp theo. Khả năng sinh enzym của 11 chủng Bacillus được lựa chọn được trình bày trong bảng 8.



Bảng 8: Khả năng sản sinh enzym (thể hiện bằng đường kính vòng phân giải cơ chất D-d, mm) của 11 chủng vi khuẩn Bacillus.

TT

Ký hiệu chủng

Amylaza (D-d, mm)

Xenlulaza (D-d, mm)

1

H3

34

30

2

M51

32

28

3

H4

30

27

4

M73

29

24

5

B71

16

15

6

M12

15

14

7

B75

18

16

8

D11

9

8

9

M16

10

9

10

M17

11

10

11

M21

8

8

(D-d là đường kính vòng phân giải cơ chất)



H×nh 3. Sơ đồ minh họa hoạt tính amylaza của 11 chủng vi khuẩn Bacillus

Kết quả ở bảng 8 trên cho ta thấy cả 11 chủng vi khuẩn Bacillus được lựa chọn thì hoạt tính enzym amylaza và xenlulaza mạnh nhất thuộc về chủng H3, tiếp đến là các chủng M51, H4 và M73 (đường kính vòng phân giải từ 24-34 mm). (Hình minh họa hoạt tính enzym của một số chủng Bacillus có trong hình 6, 7, 8 thuộc phụ lục 1).



3.2.2.2. Đánh giá khả năng kháng các vi khuẩn kiểm định

11 chủng có hoạt tính enzym mạnh nhất được lựa chọn để đánh giá tiếp hoạt tính kháng vi khuẩn kiểm định. Các kết quả nghiên cứu khả năng kháng khuẩn của 11 chủng vi khuẩn Bacillus được trình bày ở các bảng 9.



Các kết quả ở bảng 9 cho thấy, trong 11 chủng được lựa chọn thì 09 chủng Bacillus không có khả năng kháng các vi khuẩn kiểm định và 2 chủng có khả năng kháng các vi khuẩn kiểm định (H3 và H4) nhưng với hàm lượng rất thấp và cả 2 chủng này đều không kháng vi khuẩn E.coli. Vì vậy 2 chủng H3 và H4 được dùng trong các nghiên cứu tiếp theo. (Hình minh họa hoạt tính kháng khuẩn của một số chủng Bacillus có trong hình 9 thuộc phụ lục 1).
Bảng 9: Hoạt tính kháng khuẩn của 11 chủng vi khuẩn Bacillus

TT

Ký hiệu chủng

Hoạt tính kháng khuẩn (D-d, mm)

Salmonella entriristic

E. coli

Shigella flexneri

1

H3

0,5

0

2

2

M51

0

0

0

3

H4

0,5

0

2,8

4

M73

0

0

0

5

B71

0

0

0

6

M12

0

0

0

7

B75

0

0

0

8

D11

0

0

0

9

M16

0

0

0

10

M17

0

0

0

11

M21

0

0

0

(D-d là đường kính vòng kháng khuẩn)

3.2.3. Nấm men



3.2.3.1. Đánh giá khả năng kháng vi khuẩn kiểm định

Trong số 45 chủng nấm men đã được phân lập, các chủng được xác định khả năng kháng các vi khuẩn kiểm định. 01 chủng được xác định là có khả năng kháng các vi khuẩn kiểm định là chủng SB. Kết quả tóm tắt được trình bày ở bảng 10, 11.



Bảng 10: Số lượng chủng nấm men có hoạt tính kháng khuẩn

Hoạt tính kháng khuẩn

Số lượng chủng

Tỷ lệ (%)



01

2,2

Không

44

97,8

Tổng

45

100


Bảng 11: Hoạt tính kháng khuẩn của chủng nấm men SB

Khả năng kháng khuẩn (D-d, mm)

Salmonella entriristic

E. coli

Shigella flexneri

0

0

10

(D-d là đường kính vòng kháng khuẩn)

Các số liệu ở bảng 11 cho thấy, chủng SB chỉ có khả năng kháng Shigella, còn không kháng E.coli Salmonella. Tuy không có một số đặc tính probiotic như các vi khuẩn lactic và Bacillus, nhưng các chủng nấm men hữu ích tác động có lợi đối với vật nuôi qua một số cơ chế sau: (i) kích hoạt một số enzym thuộc nhóm disacharridaza (surcraza, lactaza, maltaza) làm tăng khả năng tiêu hoá đường đa (Buts và ctv, 1986); (ii) trung hòa một số loại độc tố của vi khuẩn (Castagliuolo và ctv, 1998); (iii) kết dính một số vi khuẩn gây bệnh có roi bám vào biểu mô ruột nhờ các thụ quan mannose và loại chúng ra ngoài theo phân (Czerucka và ctv, 2002); (iv) kích thích hệ miễn dịch, tăng sản xuất IgA (Qamar et al, 2001).

Từ phần tuyển chọn các chủng vi sinh vật 09 chủng lactic (1K8, 2M33, 6H2, C3, Đ2, Đ12, Đ7, NC1 và NC2), 02 chủng vi khuẩn Bacillus (H3 và H4) và 01 chủng nấm men (SB) được dùng trong nghiên cứu tiếp theo.

3.3. Phân loại các chủng được tuyển chọn

3.3.1. Nghiên cứu phân loại vi khuẩn lactic

Việc phân loại các chủng vi khuẩn được tiến hành căn cứ vào các kết quả nghiên cứu về đặc điểm hình thái, sinh lý, sinh hoá và phân tích, giải trình tự gen 16S rARN.



Bảng 12 trình bày các đặc điểm hình thái, sinh lý và sinh hoá của 09 chủng vi khuẩn lactic. Tất cả 09 chủng vi khuẩn lactic đều thuộc nhóm vi khuẩn Gram dương, phản ứng catalaza âm tính và có 3 dạng hình thái khác nhau: hình que ngắn (1K8; NC1; NC2), hình que dài (2M33; C3; Đ12 và Đ2) và hình cầu chuỗi (6H2 và Đ7). Khả năng đồng hoá tinh bột của các chủng không cao (chỉ có 2 chủng có khả năng nhưng ở mức độ yếu là 1K8; Đ7).

Bảng 12: Đặc điểm hình thái, sinh lý, sinh hoá của các chủng vi khuẩn


Đặc điểm

Ký hiệu chủng giống

1K8

2M33

6H2

C3

Đ2

Đ12

Đ7

NC1

NC2

Hình dạng tế bào

Que ngắn

Que dài

Hình cầu chuỗi

Que dài

Que dài

Que dài

Hình cầu, chuỗi

Que ngắn

Que ngắn

Nhuộm Gram

Gram +

Gram +

Gram +

Gram +

Gram +

Gram +

Gram +

Gram +

Gram +

Phản ứng catalaza

-

-

-

-

-

-

-

-

-

Khả năng đồng hoá nguồn hydrat cacbon

Riboza

-

+

+

+

+

+

++

-

+

Xyloza

-

+

+

++

+

+

+

-

+

Arabinoza

+

+

+

+

+

+

+

+

+

Rhamnoza

+

+

+

+

-

+

+

+

+

Trehaloza

+

++

++

++

++

++

+

+

++

Lactoza

+++

+++

++

+++

+++

+++

+

+++

++

Mannitol

++

++

+

+

++

++

+

++

++

Sucroza

+++

+++

++

+++

+++

+

+++

+++

+++

Cellobioza

+++

+++

++

++

+++

+++

++

+++

+++

Raffinoza

++

++

+

++

++

+

+

++

++

Galactoza

+

+++

+++

+++

+

+++

++

+

++

Tinh bột

+

++

-

-

-

-

-

+

-

Gluconat

++

++

+

++

+

+++

+++

++

+++

Fructoza

+

++

+

++

++

+++

+

+

++
Căn cứ vào khoá phân loại của Bergeys (1982) và Okada (1992) trên cơ sở các đặc điểm hình thái, sinh lý và sinh hóa, 09 chủng trên được xác định thuộc các chi Lactobacillus (1K8, 2M33, Đ2, Đ12, C3, NC1 và NC2), Streptococcus (Đ7) và Enterococcus (6H2). Để phân loại đến loài, 9 chủng vi khuẩn này được trình tự gen rARN 16S và được so sánh với các loài có quan hệ họ hàng gần. Kết quả giải trình tự gen mã hóa cho rARN 16S được trình bày ở bảng 13.

Bảng 13: Kết quả giải trình tự gen mã hoá cho rARN 16S (xem phụ lục 2)

Chủng

Kích thước đoạn gen đã được đọc (bp)

Gần gũi với loài (BLAST Search)

Tỷ lệ tương đồng (%)

1K8

1400

Lactobacillus plantarum

99

2M33

1306

Lactobacillus plantarum

99,7

6H2

1306

Enterococcus faecium

99,8

C3

1450

Lactobacillus acidophilus

99,8

Đ2

1270

Lactobacillus plantarum

99,7

Đ12

1532

Lactobacillus plantarum

99,9

Đ7

1547

Pediococcus pentosaceus

99,7

NC1

1450

Lactobacillus fermentum

99,7

NC2

1499

Lactobacillus casei

99,9

Kết quả giải trình tự gen mã hóa rARN 16S của 09 chủng vi khuẩn lactic cho thấy có 4 chủng có trình tự tương đồng gần gũi với loài Lactobacillus plantarum (1K8, 2M33, Đ2, Đ12), còn lại 5 chủng trình tự tương đồng với các loài Lactobacillus fermentum (NC1), Enterococcus faecium (6H2), Lactobacillus acidophilus (C3), Pediococcus pentosaceus (Đ7) và Lactobacillus casei (NC2).

3.3.2. Nghiên cứu phân loại vi khuẩn Bacillus



Tương tự như đối với vi khuẩn lactic, việc phân loại các chủng vi khuẩn Bacillus, được tiến hành căn cứ vào các kết quả nghiên cứu về đặc điểm hình thái, sinh lý, sinh hoá và xác định trình tự gen. Các số liệu được trình bày ở các bảng 14 và 15.


Bảng 14: Đặc điểm hình thái, sinh lý, sinh hoá của 2 chủng H3 và H4

Đặc diểm

Ký hiệu chủng

H3

H4

Hình thái tế bào

Tế bào hình que và nhỏ, nối lại thành sợi dài

Tế bào hình que, đơn và nhỏ

Khả năng sinh bào tử

Bào tử hình bầu dục, lệch tâm

Bào tử hình bầu dục, gần tâm

Nhuộm Gram

Gram +

Gram +

Khả năng đồng hóa hydratcacbon

D-Maltoza

+

+

D-Glucoza

+

+

Fructoza

+

+

Lactoza

-

-

Sacaroza

++

+

Galactoza

+

+

D-Xyloza

+

+

Cellobioza

++

++

Raffinoza

+

+

Galactoza

+

+

Tinh bột

++

++

Gluconat

++

++

Bảng 15: Kết quả giải trình tự gen mã hoá cho rARN 16S của 2 chủng Bacillus H3 và H4 (xem phụ lục 2)

Chủng

Kích thước đoạn gen đã được đọc (bp)

Gần gũi với loài (BLAST Search)

Tỷ lệ tương đồng (%)

H3

1450

Bacillus licheniformis

99,7

H4

1544

Bacillus subtilis

99,5

3.3.3. Nghiên cứu phân loại vi khuẩn nấm men

Tương tự như đối với vi khuẩn, việc phân loại các chủng nấm men được tiến hành căn cứ vào các kết quả nghiên cứu về đặc điểm hình thái, sinh lý, sinh hoá và xác định trình tự gen. Các số liệu được trình bày ở các bảng 16 và 17.



Bảng 16: Một số đặc tính hình thái và sinh lý sinh hoá của chủng nấm men SB

Đặc điểm

Chủng SB

Hình dạng tế bào

Hình trứng, elíp, nảy chồi 1 phía

Hình thái khuẩn lạc

Trắng sữa tròn nhẵn bóng lồi có vòng đồng tâm




Khả năng đồng hoá nguồn cacbohydrat

Khả năng lên men nguồn cacbohydrat

Sorboza

-

-

Xyloza

-

-

Arabinoza

-

-

Rhamnoza

-

-

Trehaloza

+

+

Lactoza

-

-

Sucroza

+

+

Cellobioza

-

-

Raffinoza

+

+

Galactoza

+

+

Tinh bột

-

-

Melibioza

-

-

Glucoza

+

+

Bảng 17: Kết quả giải trình tự gen mã hoá cho đoạn ITS rARN của chủng SB (xem phụ lục 2)

Kích thước đoạn gen đã được đọc (bp)

Gần gũi với loài (BLAST Search)

Tỷ lệ tương đồng (%)

570

Saccharomyces boulardii

100

Kết hợp số liệu thu được từ các bảng 12, 13, 14, 15, 16 và 17 chúng tôi xác định các tên loài của 9 chủng vi khuẩn lactic, 2 chủng Bacillus và 1 chủng nấm men lựa chọn trong bảng 18.

Bảng 18: Kết quả định danh các chủng vi sinh vật probiotic

STT

Kí hiệu

Tên loài

1

1K8

Lactobacillus plantarum

2

2M33

Lactobacillus plantarum

3

6H2

Enterococcus faecium

4

C3

Lactobacillus acidophilus

5

Đ2

Lactobacillus plantarum

6

Đ12

Lactobacillus plantarum

7

Đ7

Pediococcus pentosaceus

8

NC1

Lactobacillus fermentum

9

NC2

Lactobacillus casei

10

SB

Saccharomyces boulardii

11

H3

Bacillus licheniformis

12

H4

Bacillus subtilis

Các kết quả ở bảng trên cho thấy các chủng được lựa chọn đều là những chủng vi sinh vật lành tính, không phải là các vi sinh vật gây bệnh và được sử dụng rất phổ biến để tạo ra các chế phẩm probiotic.

3.4. Nghiên cứu điều kiện nuôi cấy thích hợp lên khả năng sinh trưởng của các chủng vi sinh vật được lựa chọn

3.4.1. Ảnh hưởng của các điều kiện nuôi cấy lên khả năng sinh trưởng của vi khuẩn lactic

3.4.1.1. Ảnh hưởng của nhiệt độ nuôi cấy

Nuôi lắc 220 vòng/phút 09 chủng vi khuẩn lactic trong bình tam giác chứa 20ml môi trường MRS dịch thể ở các nhiệt độ khác nhau từ 30-450C. Sau 48 giờ nuôi cấy thu dịch lên men đo OD và định lượng axit lactic tạo ra. Kết quả được trình bày ở bảng 19.



Bảng 19: Ảnh hưởng của nhiệt độ nuôi cấy đến khả năng sinh trưởng (OD660) và sản sinh axit lactic (g/l) của 09 chủng lactic

Ký hiệu chủng

Nhiệt độ nuôi cấy (oC)

30 oC

37 oC

40 oC

45 oC

OD660

HA

OD660

HA

OD660

HA

OD660

HA

1K8

2,131

2,52

2,157

2,57

0,354

0,92

0,241

0,63

2M33

1,654

2,34

1,876

2,39

0,426

1,15

0,354

0,68

6H2

1,466

1,48

1,481

1,53

1,134

1,28

0,221

0,65

C3

1,941

2,3

2,088

2,7

0,318

0,68

0,189

0,55

Đ2

1,912

1,95

2,121

2,09

0,985

0,89

0,208

0,78

Đ12

1,859

2,36

1,974

2,31

0,856

1,12

0,112

1,01

Đ7

1,945

2,34

2,029

2,43

1,119

1,26

0,195

0,86

NC1

1,578

2,68

1,924

3,08

1,234

1,8

0,667

0,63

NC2

1,657

2,34

1,885

2,58

1,053

1,1

0,725

0,49

HA: Hàm lượng axit lactic (g/l)

Kết quả ở bảng 19 cho thấy, khả năng sinh trưởng của vi khuẩn lactic thể hiện bằng mật độ quang OD660 tăng khi nhiệt độ tăng từ 30oC lên đến 37oC. Khi nhiệt độ tăng lên trên 37oC (40 và 45oC) mật độ quang giảm rõ rệt. Qui luật này quan sát thấy ở cả 09 chủng vi khuẩn. Các số liệu ở bảng 19 cũng cho thấy, nhiệt độ từ 30oC đến 37oC là thích hợp nhất đối với các chủng vi khuẩn lactic. Tuy nhiên, trong vùng nhiệt độ tối thích này, mật độ quang của các chủng cũng rất khác nhau. Khả năng sinh trưởng ở nhiệt độ 37oC thể hiện qua chỉ số OD660 xếp theo thứ tự cao (OD660≥2) gồm 4 chủng (1K8, Đ2, C3, Đ7), trung bình (1,5660<2) gồm 4 chủng (Đ12, 2M33, NC1 và NC2) và thấp (OD660 ≤1,5) gồm 1 chủng (6H2).

Khả năng sản sinh axit lactic của các chủng vi khuẩn cũng có xu hướng tương tự như khả năng sinh trưởng. Nhìn chung, những chủng có khả năng sinh trưởng tốt cũng là những chủng có khả sản sinh axit lactic cao. Kết quả nghiên cứu của Phạm Thị Ngọc Lan và ctv (2003) cho thấy, khi phân lập từ phân gà tươi 789 chủng vi khuẩn lactic, có hai chủng được lựa chọn (CH123 và CH156) là có các đặc tính probiotic và cả hai chủng đều có khả năng sinh trưởng ở khung nhiệt độ từ 15 đến 45oC.

3.4.1.2. Ảnh hưởng của pH môi trường dịch nuôi cấy

Nuôi lắc 220 vòng/phút các chủng lactic trong môi trường MRS có pH khác nhau từ 2,0 đến 7,0 ở nhiệt độ 370C trong 48 giờ. Kết quả nghiên cứu được trình bày ở bảng 20.





hiệu chủng

pH

2

3

4

5

6

7

OD

HA

OD

HA

OD

HA

OD

HA

OD

HA

OD

HA

1K8

0,175

1,76

0,191

2,06

0,713

2,21

0,181

1,89

0,163

0,72

0,162

0,42

2M33

0,043

1,01

0,081

1,52

0,696

1,78

0,044

1,04

0,038

0,58

0,029

0,33

6H2

0,022

1,42

0,042

1,63

0,732

2,04

0,038

1,53

0,019

1,01

0,007

0,45

C3

0,019

1,04

0,024

1,44

0,73

2,04

0,021

1,13

0,012

0,68

0,008

0,38

Đ2

0,015

0,95

0,019

1,27

0,645

1,85

0,017

1,04

0,015

0,9

0,013

0,42

Đ12

0,048

0,72

0,08

1,94

0,671

2,32

0,052

1,04

0,014

0,65

0,012

0,35

Đ7

0,046

1,49

0,092

1,96

0,585

2,29

0,077

1,89

0,038

0,95

0,01

0,62

NC1

0,609

2,55

0,73

2,5

0,725

2,48

0,71

2,56

0,400

2,45

0,173

2,4

NC2

0,690

2,18

0,8

2,18

0,805

2,12

0,789

2,2

0,578

2,08

0,257

2,0

Bảng 20: Ảnh hưởng pH nuôi cấy đến khả năng sinh trưởng (OD660) và khả năng sản sinh axit lactic (g/l).

HA= Hàm lượng axit lactic (g/l)

Kết quả ở bảng 20 cho thấy với dải pH rộng: 2; 3; 4; 5; 6 và 7, đáp ứng về sinh trưởng và khả năng sản sinh axit lactic của 09 chủng vi khuẩn lactic là khác nhau. Các số liệu ở bảng 20 cũng cho thấy mật độ quang (OD660) ở môi trường có độ pH 4 của 07 chủng là cao nhất (dao động từ 0,58 đến 0,8), riêng chủng NC1 thì tại pH 3 mật độ quang và hàm lượng axit lactic sinh ra là cao hơn cả. Ở môi trường có độ pH cao hơn (từ 5 trở lên) mật độ quang giảm. Khả năng sản sinh axit lactic cũng có xu hướng tương tự. Điều đó chứng tỏ các vi khuẩn lactic chỉ sinh trưởng tốt trong môi trường có độ pH thấp (3-4) và ở môi trường pH cao hơn (pH từ 5-7) tốc độ sinh trưởng của chúng chậm, nhưng chúng vẫn tồn tại. Những kết quả nghiên cứu này cũng phù hợp với các kết quả nghiên cứu của Phạm Thị Ngọc Lan và ctv (2003) trên hai chủng CH123 và CH156 thuộc các vi khuẩn lactic, hai chủng này cũng chỉ sinh trưởng tốt ở môi trường có độ pH thấp (pH = 4).



3.4.1.3. Ảnh hưởng của muối mật trong môi trường nuôi cấy

Khả năng chịu được muối mật ở các nồng độ khác nhau là một trong những tiêu chí quan trọng để đánh giá các đặc tính probiotic của các chủng vi khuẩn đã được lựa chọn. Nồng độ muối mật trong dưỡng chấp của đường tiêu hoá của động vật có vú dao động từ 1 đến 3% (Sameh. H. M, 2003). Các chủng vi khuẩn hữu ích muốn khu trú và phát huy tác dụng được trong đường tiêu hoá của các loài vật nuôi phải sống và sinh trưởng bình thường trong môi trường có hàm lượng muối mật tương tự. Kết quả nghiên cứu ảnh hưởng của môi trường có hàm lượng muối mật khác nhau đến sinh trưởng của các chủng vi khuẩn lactic được trình bày ở bảng 21.



Bảng 21: Ảnh hưởng của môi trường nuôi cấy có nồng độ muối mật khác nhau đến khả năng sinh trưởng của các chủng vi khuẩn lactic.

Ký hiệu chủng

Nồng độ muối mật (%)

0,2

0,5

1

2

3

4

5

1K8

++

+++ 

+++

++++

+++

+++

++

2M33

 +



+

+++

++

-

-

6H2

++

+++ 

+++

+++

+++

++++

++

C3

 +

++ 

++

+++

+

+

-

Đ2

 ++

++ 

++

+++

+

-

-

Đ12

 ++

+++ 

+++

++

++

++++

++

Đ7

 +



+

+++

+

+

-

NC1

++

+++

+++ 

+++ 

+++ 

++ 

++ 

NC2



++ 

+++ 

+++ 

+++ 

++ 



(+): biểu thị khả năng sinh trưởng; (-):biểu thị khả năng không sinh trưởng.

Kết quả bảng 21 cho thấy, nhìn chung tất cả các chủng đều chịu được nồng độ muối mật 1-3%, đó là nồng độ muối mật bình thường trong dưỡng chấp của ruột non. Tuy nhiên, khả năng chịu muối mật giữa các chủng là không giống nhau. Trong số 09 chủng, có 5 chủng có khả năng sinh trưởng ở nồng độ muối mật 5%; 4 chủng chịu được nồng độ muối mật 4%. Các chủng có khả năng sinh trưởng trong môi trường muối mật cao (từ 4-5%) là 1K8; 6H2; Đ12; Đ7; NC1; NC2 và C3.

3.4.2. Ảnh hưởng của các điều kiện nuôi cấy lên khả năng sinh trưởng của vi khuẩn Bacillus

3.4.2.1. Ảnh hưởng của nhiệt độ nuôi cấy

Nuôi lắc 02 chủng vi khuẩn Bacillus trong bình tam giác chứa 20ml môi trường LB dịch thể ở các nhiệt độ khác nhau từ 30-550C. Sau 24 giờ nuôi cấy thu dịch lên men đo OD và định lượng hàm lượng enzym tạo ra. Kết quả được trình bày ở bảng 22.



Bảng 22: Ảnh hưởng của nhiệt độ nuôi cấy đến khả năng sinh trưởng (OD660) và sản sinh enzym của 02 chủng Bacillus

Nhiệt độ(oC)

Chủng H3

Chủng H4

OD660

Amylaza (D-d, mm)

Xenlulaza (D-d, mm)

OD660

Amylaza (D-d, mm)

Xenlulaza (D-d, mm)

300C

2,213

29

26

2,013

27

24

370C

2,534

34

30

2,234

30

27

400C

1,876

35

30

1,576

29

28

450C

1,185

28

24

0,885

22

23

(D-d, mm: vòng phân giải cơ chất)

Kết quả ở bảng 22 cho thấy, khả năng sinh trưởng của 2 vi khuẩn Bacillus tăng khi nhiệt độ tăng từ 30oC lên đến 37oC. Khi nhiệt độ tăng lên trên 37oC (40 và 45oC) mật độ quang giảm, tuy nhiên sự giảm này không nhiều như vi khuẩn lactic. Điều này có thể hiểu được vì các chủng Bacillus chịu các điều kiện bất lợi tốt hơn vi khuẩn lactic. Tuy nhiên, nhiệt độ thích hợp cho enzym amylaza, xenlulaza hoạt động của chủng H4 là 400C, chủng H3 là 370C. Ở nhiệt độ nuôi cấy cao hơn (450C), hoạt tính của các enzym giảm dần. Do đó, nhiệt độ 37oC là thích hợp nhất cho sự sinh trưởng và sản sinh enzym của 02 chủng vi khuẩn Bacillus.



3.4.2.2. Ảnh hưởng của pH môi trường dịch nuôi cấy

Nuôi lắc 220 vòng/phút các chủng Bacillus trong môi trường LB có pH khác nhau từ 2,0 đến 7,0 ở nhiệt độ 370C trong 24 giờ. Kết quả nghiên cứu cho thấy cả 2 chủng Bacillus sinh trưởng ở môi trường có pH từ 5-7 tốt hơn khi so với môi trường có pH <5. Tuy nhiên hoạt tính enzym mạnh nhất là khi nuôi cấy tại môi trường có pH 7.



3.4.2.3. Ảnh hưởng của muối mật trong môi trường nuôi cấy

Tương tự như với vi khuẩn lactic, kết quả về sự ảnh hưởng của môi trường nuôi cấy có nồng độ muối mật khác nhau được trình bày ở bảng 23.



Bảng 23: Ảnh hưởng của môi trường nuôi cấy có nồng độ muối mật khác nhau đến khả năng sinh trưởng của các chủng vi khuẩn Bacillus.

Ký hiệu chủng

Nồng độ muối mật (%)

0,2

0,5

1

2

3

4

5

H4

++

+++ 

+++

++++

+++

+++

++

H3

 +

+ +

++

+++

++++

+++

++

(+): biểu thị khả năng sinh trưởng

Kết quả bảng 23 cho thấy, cả 2 chủng đều chịu được nồng độ muối mật 0,2-5% nhưng khả năng chịu muối mật giữa các chủng là không giống nhau. Trong đó chủng H4 sinh trưởng tốt nhất là ở môi trường có nồng độ muối mật 2% còn chủng H3 là 3%. Nói chung, nồng độ muối mật thích hợp cho sự sinh trưởng của 2 chủng Bacillus là 1-4%.

3.4.3. Ảnh hưởng của các điều kiện nuôi cấy lên khả năng sinh trưởng của nấm men

3.4.3.1. Ảnh hưởng của nhiệt độ nuôi cấy

Nuôi cấy lắc 120 vòng/phút chủng nấm men SB trong bình tam giác chứa 20ml môi trường YM dịch thể ở các nhiệt độ khác nhau từ 30-450C. Sau 24 giờ nuôi cấy, dịch nuôi cấy được đếm số lượng tế bào (CFU/ml). Kết quả được trình bày trong bảng 24.



Bảng 24: Ảnh hưởng của nhiệt độ nuôi cấy đến khả năng sinh trưởng của chủng nấm men SB (CFU/ml).

Nhiệt độ nuôi cấy (oC)

Số lượng tế bào (CFU/ml)

30 oC

2 x 109

37 oC

6 x 107

40 oC

4 x 106

450C

3,8 x 103

Kết quả ở bảng 24 cho thấy chủng nấm men SB phát triển tốt ở phạm vi nhiệt độ từ 30-37oC, sinh trưởng tốt nhất là 300C. Khi nuôi cấy ở nhiệt độ cao hơn (40 và 45oC) sinh khối giảm rõ rệt (từ 2 x 109 ở 30oC xuống 3,8 x 103 cfu/ml ở 45oC). Đáp ứng về sinh trưởng đối với nhiệt độ nuôi cấy ở chủng nấm men SB có xu hướng tương tự như đối với nhóm vi khuẩn lactic.

3.4.3.2. Ảnh hưởng của pH nuôi cấy

Một đặc tính rất quan trọng khác của các vi sinh vật probiotic là khả năng sống trong các môi trường có độ pH khác nhau. Các kết quả nghiên cứu ảnh hưởng của pH môi trường nuôi cấy đến sinh trưởng của chủng nấm men SB được trình bày ở bảng 25.



Bảng 25: Ảnh hưởng của pH môi trường nuôi cấy đến khả năng sinh trưởng của chủng nấm men SB.

pH môi trường

2

3

4

5

6

7

Số lượng tế bào (CFU/ml)

1x107

2,7x108

4,6x108

2,2x109

4x109

2,5x108

Kết quả ở bảng 25 cho thấy khả năng sinh trưởng của chủng SB không thay đổi nhiều khi pH môi trường thay đổi (2; 3; 4; 5; 6 và 7). Tuy nhiên, chủng SB phát triển mạnh hơn ở môi trường có độ pH 5 và 6. Ở môi trường pH 7 mật độ các chủng giảm nhưng vẫn duy trì được ở mức 2,5 x 108 cfu/ml. Kết quả này cho thấy, chủng SB được lựa chọn đều có khả năng sống trong môi trường pH thay đổi từ rất toan (pH = 2) đến trung tính. Điều này có ý nghĩa rất quan trọng đối với các vi sinh vật probiotic vì muốn phát huy tác dụng, chúng phải thích ứng được với môi trường trong đường dạ dày-ruột của lợn và gà, nơi mà độ pH môi trường thay đổi (từ rất toan ở dạ dày đến gần trung tính ở ruột non).

3.4.3.3. Ảnh hưởng của muối mật trong môi trường nuôi cấy

Khi thực hiện thí nghiệm đánh giá khả năng chịu muối mật của chủng SB chúng tôi nhận thấy chủng này đều phát triển bình thường (không có sự khác biệt đáng kể giữa mẫu thí nghiệm có nồng độ muối mật khác nhau (1-5%) và mẫu đối chứng khi không có mặt muối mật).

Trên cơ sở phân loại, đánh giá các đặc tính probiotic, 6 chủng vi sinh vật được sử dụng trong các nghiên cứu tiếp theo. Các chủng vi sinh vật bao gồm: 4 chủng vi khuẩn lactic (6H2, C3, Đ7, NC1); 1 chủng vi khuẩn Bacillus (H4) và 1 chủng nấm men (SB).

3.5. Phát triển chế phẩm

3.5.1. Kết quả về tính đối kháng của các chủng được lựa chọn

Bằng phương pháp cấy vạch để thử tính đối kháng, kết quả thu được cho thấy 6 chủng nghiên cứu không có tính đối kháng lẫn nhau.

3.5.2. Các kết quả nghiên cứu về tính tương thích của các chủng được lựa chọn với một số thành phần có hoạt tính bổ sung trong thức ăn

Trong số các yếu tố ảnh hưởng đến sức sống và hoạt tính của các vi sinh vật probiotic thì sự tương tác của chúng đối với các thành phần khẩu phần (chủ yếu là các thành phần có hoạt tính như một số loại muối vô cơ, các chất axit hóa và một số loại kháng sinh) có một ý nghĩa rất quan trọng. Kết quả nghiên cứu về tương thích của các vi sinh vật lựa chọn đối với một số thành phần có hoạt tính bổ sung trong khẩu phần (gồm các loại kháng sinh thương mại BMD (50 ppm); Saigon Nox (100 ppm), Colistine 98% (100 ppm), CTC 15% (100 ppm); một số loại khoáng CuSO4 (250 ppm Cu); ZnSO4 (100 ppm Zn) và hỗn hợp axit hữu cơ (gồm axit lactic axit, axit formic, axit citric...) với liều 200mg/lít) được trình bày ở bảng 26.



Bảng 26: Khả năng sinh trưởng của các chủng vi sinh vật được lựa chọn trong môi trường có chứa một số thành phần có hoạt tính bổ sung trong khẩu phần ăn.

Thành phần

Số lượng tế bào ( CFU/ml)




C3

Đ7

6H2

NC1

SB

H4

Đối chứng

7,0 x 108

8 x 1010

7,6 x 109

5,2 x 109

2,0 x 109

6 x 1010

Kháng sinh



















- BMD

4,3 x 103

2,5 x 106

3,9 x 109

4,8 x 109

7,5 x 108

6,2 x 108

- Saigon Nox

120

4 x 104

4,8 x 103

1,1 x 103

6,8 x 108

9,8 x 105

- Colistine

7,0 x 108

3,2 x 109

5,8 x 109

2,8 x 109

5,6 x 108

2,0 x 1010

- CTC

3,7 x 104

6 x 104

3,4 x 104

2,6 x 104

1,0 x 108

2,0 x 105

Muối khoáng



















- CuSO4.5H2O

5,7 x 108

1 x 1010

6,8 x 109

1,8 x 109

1,0 x 109

7,2 x 109

- ZnSO4.5H2O

6,0 x 108

9,3 x 109

4 x 109

8,8 x 108

9,0 x 108

8,0 x 109

Hỗn hợp axit hữu cơ

5,2 x 107

1 x1010

9,2 x 108

4 x109

1,8 x109

3,0 x 109

*Saigon Nox: Kitasamycin 50g/kg + Sulphamethazon 50g/kg.

BMD: Bacitracin Methylene disalicylate

CTC: Chlotetracyline

Kết quả ở bảng 26 cho thấy, chủng nấm men (SB) và vi khuẩn Bacillus (H4) vẫn sinh trưởng và phát triển bình thường trong môi trường hiện diện một số loại kháng sinh, các muối sulfat của đồng và kẽm cũng như hỗn hợp một số loại axit hữu cơ với liều tương tự như liều khuyến cáo bổ sung trong khẩu phần. Trong số các vi khuẩn lactic, chủng 6H2 và NC1 sống tốt trong môi trường có BMD, Colistine, CuSO4.5H2O và ZnSO4.5H2O và hỗn hợp axit hữu cơ, ngoại trừ Saigon Nox và CTC. Hai chủng vi khuẩn lactic còn lại (C3 và Đ7) phát triển yếu trên môi trường có BMD, Saigon Nox và CTC. Qua kết quả đó cho thấy, các chủng vi khuẩn nghiên cứu có tính tương thích cao với các axit hữu cơ, các muối sulfat của đồng và kẽm và một số loại kháng sinh được sử dụng phổ biến trong thức ăn chăn nuôi. Điều này có ý nghĩa rất quan trọng trong việc hướng dẫn sử dụng các sản phẩm probiotic có chứa các chủng trên trong chăn nuôi lợn và gà. Với những sản phẩm probiotic mà các chủng vi sinh vật có tính tương thích càng cao với các thành phần có hoạt tính trong khẩu phần thức ăn thì tính ứng dụng càng lớn. Bởi trong công nghệ chế biến thức ăn chăn nuôi, probiotic chỉ là một chất bổ sung cùng với các thành phần khác vào thức ăn (như một số loại kháng sinh, các muối sulfat của đồng và kẽm cũng như hỗn hợp một số loại axit hữu cơ với tỷ lệ tượng tự như thí nghiệm và kết quả ở bảng 26).

3.5.3. Kết quả đánh giá khả năng bám dính của các chủng probiotic

Khả năng bám dính vào niêm mạc đường tiêu hoá của 06 chủng sinh vật được trình bày ở bảng 27.



Bảng 27: Khả năng bám dính của các chủng vi sinh vật trên biểu mô ruột.

TT

Ký hiệu chủng

Nồng độ ban đầu

(CFU/ ml)

Khả năng bám dính

(CFU/ gam ruột)

1

Đối chứng âm

6 x 109

1,8 x 102

2

Đ7

7,6 x 108

1 x 107

3

NC1

6,28 x 109

1,5 x 108

4

6H2

2,4 x 109

1 x 108

5

H4

5 x 109

2 x 108

6

C3

4,6 x 109

2,6 x 107

7

SB

3,8 x 109

4 x 108

Các kết quả ở bảng 27 cho thấy, các chủng vi sinh vật đều bám dính tốt vào niêm mạc ruột nhưng mức độ không giống nhau. Chủng nấm men tỏ ra có độ bám dính cao hơn so với các chủng vi khuẩn. Các chủng vi khuẩn lactic, Bacillus và nấm men đều có khả năng sống và phát triển trong môi trường tương tự như trong đường tiêu hóa của lợn và gia cầm. Điều này rất thích hợp khi phát triển các chế phẩm probiotic sau này.

3.5.4. Ảnh hưởng của việc bổ sung các chế phẩm probiotic vào khẩu phần đến tốc độ sinh trưởng và hiệu quả sử dụng thức ăn của lợn con.

Chúng tôi sử dụng 6 chủng cho phát triển sản phẩm thử nghiệm theo 2 tổ hợp khác nhau: tổ hợp PBB1 có hai chủng Bacillus (H4) và nấm men Sacharomyces boulardii (SB) và tổ hợp PBB2 gồm 6 chủng nghiên cứu (4 chủng lactic: 6H2, C3, NC1, Đ7; 01 chủng Bacillus (H4) và chủng nấm men Sacharomyces boulardii (SB)). Theo đánh giá của chúng tôi đây là các chủng tiềm năng nhất.

Kết quả sử dụng chế phẩm PBB1 và PBB2 trên lợn con (trọng lượng 7,7 - 8,1kg) sau 50 ngày thí nghiệm được trình bày trong bảng 28.



Bảng 28: Ảnh hưởng của việc bổ sung các chế phẩm Probiotic vào khẩu phần đến sinh trưởng và hiệu quả sử dụng thức ăn của lợn con.

Chỉ tiêu

Lô 1

ĐC (-)


Lô 2

ĐC (+)


Lô 3 (PBB1)

Lô 4

(PBB2)


SE

P

SL lợn mỗi lô (c)

24

24

24

24







KL bắt đầu (kg)

7.7

8.0

8.1

7.9

0.09

0.762

KL Kết thúc (kg)

26.7a

29.8b

28.2ab

29.9b

0.29

0.021

TĐST (g/c/ngày)

396a

454b

421ab

462b

5.36

0.013

TĂĂV (g/c/ng)

604

631

655

654

19.41

0.388

TTTĂ/kg TT (kg)

1.53ab

1.39a

1.56b

1.42ab

0.036

0.021

Ghi chú: SL: Số lượng; KL: Khối lượng; TĐST: Tốc độ sinh trưởng; ĐC (-): Đối chứng tiêu cực; ĐC (+): Đối chứng tích cực; TĂĂV: Lượng thức ăn ăn vào; TTTĂ: Tiêu tốn thức ăn. Các giá trị trung bình trong cùng một hàng mang các chữ cái khác nhau thì khác nhau ở mức P<0.05.

Sau 50 ngày thí nghiệm, lợn con ở các lô được ăn khẩu phần có bổ sung colistin và chế phẩm PBB2 có khối lượng cơ thể cao hơn các lô khác (29,8 và 29,9 kg tương ứng). Tốc độ sinh trưởng thể hiện ở chỉ tiêu tăng trọng ngày cao nhất quan sát thấy ở lợn lô 4, cao hơn so với lô đối chứng âm 16,7% (P < 0,05), nhưng cao hơn không đáng kể so với đối chứng dương 1,76% (P >0,05). Ngoại trừ lô 1, 2 và 4, tốc độ sinh trưởng của lợn ở các lô 3 dao động từ 421 đến 434 g/con/ngày và sự chênh lệch này không có ý nghĩa thống kê (bảng 28).

Tỷ lệ chuyển hóa thức ăn tốt nhất quan sát thấy ở lợn lô 2 với mức tiêu tốn là 1,39 kg thức ăn/kg tăng trọng (thấp hơn so với lô 1 9,15%), sau đến là lô 4 (1,42 kg) (thấp hơn so với lô 1 là 7,19%). Sự khác biệt về tiêu tốn thức ăn ở lô 2 và lô 4 so với các lô khác là có ý nghĩa thống kê (P < 0,05). Tiêu tốn thức ăn/kg tăng trọng của lợn ở lô 3 là 1,56 kg và sự sai khác này không có ý nghĩa thống kê.

Thông qua những kết quả về sinh trưởng và chuyển hóa thức ăn của lợn thí nghiệm như đã trình bày ở trên, có thể thấy bổ sung kháng sinh liều thấp (colistin với liều 100g/tấn) và chế phẩm probiotic đa chủng dạng bột đã cải thiện được tốc độ sinh trưởng của lợn con so với đối chứng âm (tăng 16,7%) và hiệu quả chuyển hóa thức ăn (mức tiêu tốn thấp hơn 7,19%).

Mức độ cải thiện năng suất sinh trưởng ở vật nuôi của các sản phẩm probiotic rất khác nhau phụ thuộc vào đặc tính sinh học, mật độ, sức sống, hoạt tính của các chủng vi sinh vật probiotic được sử dụng (Sanders, 2001). Trong trường hợp của nghiên cứu này, một chế phẩm probiotic đa chủng gồm cả vi khuẩn lactic, Bacillus và nấm men ở dạng bột tỏ ra có tác dụng rõ rệt và tương tự các kết quả nghiên cứu trên lợn con sau cai sữa của một số các tác giả khác như Lessard và Brisson (1987) với sản phẩm probiotic gồm 3 chủng vi khuẩn lactic (L. bulgaricus, L. casei S. thermophilus); Fialho và ctv (1998) với sản phẩm probiotic gồm 2 chủng vi khuẩn lactic và 1 chủng Bacillus (L. acidophilus; Streptococcus faecium Bacillus toyoi).

Các số liệu ở bảng 28 cũng cho thấy, cùng là chế phẩm dạng bột nhưng chế phẩm PBB1 kém hiệu quả hơn so với PBB2, nguyên nhân rất có thể do trong sản phẩm PBB2 không có các vi khuẩn lactic.



Chương 4 - KẾT LUẬN VÀ KIẾN NGHỊ

KẾT LUẬN

1. Trong 254 chủng được phân lập (164 chủng vi khuẩn lactic, 45 chủng vi khuẩn Bacillus và 45 chủng nấm men) đã đánh giá, tuyển chọn và phân loại được 12 chủng gồm 9 chủng lactic, 2 chủng Bacillus và 1 chủng nấm men. Kết quả cho thấy chúng thuộc về các loài Enterococcus faecium (6H2); Lactobacillus acidophilus (C3); Lactobacillus plantarum (1K8, Đ2, Đ12, 2M33); Pediococcus pentosaceus (Đ7); Lactobacillus casei (NC2); Lactobacillus fermentum (NC1); Bacillus licheniformic (H3); Bacillus subtilis (H4); Saccharomyces boulardii (SB).

2. Điều kiện nuôi cấy thích hợp cho các chủng vi sinh vật được lựa chọn: vi khuẩn lactic (nhiệt độ nuôi cấy 370C, pH 3-4, nồng độ muối mật 1-3%); vi khuẩn Bacillus (nhiệt độ nuôi cấy 370C, pH 5-7, nồng độ muối mật 1-4%); nấm men (nhiệt độ nuôi cấy 300C, pH 5-6 và nồng độ muối mật 1-5%).

3. Sáu chủng vi sinh vật (4 chủng vi khuẩn lactic (C3, NC1, Đ7 và 6H2), 1 chủng Bacillus (H4) và 1 chủng nấm men (SB)) được dùng để phát triển sản phẩm. Trong đó chủng vi khuẩn Bacillus (H4) và nấm men (S. boulardii) có tính tương thích cao với một số thành phần có hoạt tính bổ sung trong khẩu phần thức ăn; 4 chủng vi khuẩn lactic có tính tương thích yếu hơn. Sáu chủng này đều có khả năng bám dính tốt vào biểu mô ruột.

Sử dụng chế phẩm probiotic đa chủng dạng bột (PBB2) đã cải thiện được tốc độ sinh trưởng (tăng 16,7% so với lô đối chứng âm), tăng hiệu quả chuyển hóa thức ăn (giảm tiêu tốn thức ăn/kg tăng trọng 7,2%), giảm tỷ lệ tiêu chảy và chi phí kháng sinh điều trị ở lợn con sau cai sữa 31%.

KIẾN NGHỊ

Thử nghiệm các chế phẩm probiotic từ các chủng đã được lựa chọn trên diện rộng và trên nhiều đối tượng vật nuôi khác nhau và từ đó cho sản xuất thử chế phẩm probiotic có hiệu quả nhất.





  1   2


Cơ sở dữ liệu được bảo vệ bởi bản quyền ©hocday.com 2019
được sử dụng cho việc quản lý

    Quê hương