Lê Thị Phương XÂy dựng cơ SỞ DỮ liệu sinh học phân tử trong nhận dạng các loàI ĐỘng vật hoang dã phục vụ thực thi pháp luật và nghiên cứU


Tổng quan về phương pháp sinh học phân tử sử dụng trong nhận dạng loài



tải về 1.03 Mb.
trang5/13
Chuyển đổi dữ liệu07.07.2016
Kích1.03 Mb.
1   2   3   4   5   6   7   8   9   ...   13

1.4.Tổng quan về phương pháp sinh học phân tử sử dụng trong nhận dạng loài

1.4.1. Giới thiệu phương pháp mã vạch ADN


Nhằm tạo ra một công cụ hỗ trợ việc nhận dạng các loài phục vụ nghiên cứu đa dạng sinh học và ngăn chặn buôn bán trái phép động vật hoang dã các nhà khoa học thuộc nhóm nghiên cứu của dự án Mã vạch sự sống quốc tế (iBOL) đã thiết lập một thư viện các loài sinh vật có nhân chuẩn dựa trên một dạng phân tích mới gọi là mã vạch ADN. Công nghệ mã vạch ADN ra đời sẽ hứa hẹn một tương lai mới, nơi mà con người có thể cập nhật nhanh chóng các thông tin như tên, thuộc tính sinh học… của bất cứ loài sinh vật nào trên trái đất. Phương pháp phân tích mã vạch ADN cũng sẽ là một công cụ quan trọng trong việc bảo tồn và theo dõi các loài có tác động xấu đến sức khỏe của con người cũng như lợi ích kinh tế từ chúng. Hiện tại, các nhà nghiên cứu đã thu thập được mã ADN của hơn 80.000 loài. Dự kiến đến năm 2015, thư viện sẽ có được danh mục ADN của khoảng năm triệu mẫu sự sống, đại diện cho 500.000 loài trên trái đất. Đây chỉ là một nhóm đáng kể trong tổng số 1,7 triệu loài mà con người biết đến hiện nay. Hy vọng công nghệ này sẽ thúc đẩy việc khám phá ra rất nhiều loài còn chưa được biết đến trên trái đất.[15]

Phương pháp mã vạch phân tử là một kỹ thuật dùng để xác định đặc điểm của các loài sinh vật bằng cách sử dụng một trình tự ADN ngắn từ một vị trí gen tiêu chuẩn đã được kiểm chứng. Cũng giống như mô hình độc đáo của mã vạch trong nhận dạng sản phẩm, một mã vạch ADN là một mô hình duy nhất của trình tự ADN có thể sử dụng để nhận diện một thực thể sống. Mã vạch ADN ngắn, khoảng 700 nucleotit, có thể được sản xuất nhanh từ hàng nghìn mẫu vật và được phân tích rõ ràng trên các phần mềm máy tính. [15]

Mã vạch ADN cho phép những người không phải chuyên gia nhận dạng các loài một cách khách quan, thậm chí từ những vật liệu nhỏ, bị hư hỏng và đã được chế biến công nghiệp.

1.4.2. Các ứng dụng của phương pháp mã vạch ADN


Mã vạch ADN có thể giúp chúng ta đạt được nhiều mục tiêu phát triển thiên niên kỷ và đạt tới mục tiêu của công ước đa dạng sinh học.

*Kiểm soát côn trùng trong nông nghiệp, giảm nghèo và đói


Những mối hại do côn trùng làm cho người nông dân trên thế giới tiêu tốn hàng tỷ đô la mỗi năm. Phương pháp mã vạch ADN có thể cho phép xác định sâu bệnh ở bất kỳ giai đoạn nào của vòng đời, làm cho chúng ta dễ dàng kiểm soát chúng. Sáng kiến mã vạch Tephritid toàn cầu sẽ góp phần vào việc quản lý loài ruồi giấm và sẽ cung cấp cho thanh tra biên giới các công cụ để nhận dạng và dừng dịch ruồi qua biên giới.[14]

*Nhận dạng vectơ bệnh tật

Nhiều loại bệnh tật truyền nhiễm nguy hiểm nhất của con người và động vật như sốt sét lây truyền qua máu và các loài trung gian. Mã vạch ADN cho phép chúng ta không cần sử dụng phân loại học để nhận dạng các loài trung gian này, qua đó giúp chúng ta hiểu và kìm hãm sự phát triển của các loài côn trùng mang bệnh và các mầm bệnh. Một sáng kiến mã vạch toàn cầu về muỗi đang xây dựng một thư viện mã vạch tham khảo cái mà có thể hỗ trợ các cơ quan y tế công cộng trong việc khống chế các loài vật trung gian gây bệnh này tốt hơn và phụ thuộc ít hơn vào thuốc diệt côn trùng.[14]



*Tính bền vững của môi trường

Việc khai thác quá mức các nguồn tài nguyên như cá và cây lấy gỗ đang dẫn đến sự cạn kiệt, sự tuyệt chủng của các loài cũng như sự sụp đổ của các ngành kinh tế dựa vào chúng. Các nhà quản lý tài nguyên thiên nhiên có thể kiểm soát việc buôn bán bất hợp pháp các sản phẩm được chế biến từ chúng thông qua việc sử dụng mã vạch ADN.[14]



*Bảo vệ các loài nguy cấp

Việc thi hành pháp luật có thể sử dụng mã vạch ADN để nhận dạng các loài bị đe dọa đang được mua bán trái phép. Do vậy, mã vạch ADN đã góp phần quan trọng vào bảo tồn đa dạng sinh học.[14]



*Kiểm soát chất lượng nước

Nước uống đang ngày một trở thành nguồn tài nguyên quý giá. Chất lượng của các ao, hồ, sông, suối thường được ước lượng bằng cách nghiên cứu các vi sinh vật sống trong đó. Mã vạch ADN đang được sử dụng để xác định các loài chỉ thị này nếu không thì thật khó để xác định. Cơ quan môi trường có thể sử dụng phương pháp mã vạch để nâng cao việc đánh giá chất lượng nước, tạo ra và thực thi tốt hơn các chính sách đảm bảo cung cấp bền vững nguồn nước uống an toàn cho sức khỏe con người.[14]


1.4.3. Phương pháp mã vạch ADN ứng dụng trong nhận dạng các loài động vật hoang dã


Ứng dụng công nghệ dựa trên ADN vào việc điều tra tội phạm buôn bán và tiêu thụ động vật hoang dã đã mở ra khả năng tăng cường hiệu quả thực thi pháp luật. Ví dụ trong trường hợp sử dụng kính kiển vi để xác định loài được cho là Linh dương Tây Tạng từ những chiếc khăn quàng được dệt, việc xác định tới cấp độ loài có thể được thực hiện bằng cách sử dụng việc xác định kiểu ADN nơi mà kết quả không dựa vào phán đoán chủ quan của người kiểm tra. [13]

*Các bước thực hiện

- Thu thập mẫu vật động vật hoang dã trong khu vực hoặc vùng lân cận.

- Chiết xuất và tinh chế ADN từ mẫu mô hoặc vật liệu được chế biến.

- Khuếch đại một khu vực cụ thể của gen lục lạp hoặc ty lạp thể bằng cách PCR và phân tích sản phẩm PCR bằng phản ứng điện li keo.

- Sử dụng Blast (Basic Local Alignment Search Tool  ) để nhận diện các trình tự trong cơ sở dữ liệu.

- Sử dụng các công cụ sắp xếp nhiều trình tự và xây dựng cây để phân tích các mối quan hệ phát sinh loài.



* Vai trò của ADN

Bộ gen ty thể ở tế bào nhân chuẩn có 37 gen, 22 gen mã hóa ARN vận chuyển (tARN), 2 gen mã hóa ARN ribosomal (rARN) và 13 gen khác mã hóa protein chủ yếu liên quan đến quá trình hô hấp oxi hóa. Số lượng gen trên hệ gen ty thể phần lớn là bất biến cho tất cả các hệ gen ty thể của các loài động vật có xương sống nhưng thứ tự của các gen có thể thay đổi. Thứ tự của các vị trí trên hệ gen ty thể thì tương tự nhau trong các loài động vật có vú nhưng có thể khác nhau giữa các bậc phân loại: ví dụ thứ tự khác nhau giữa gen ty thể của gia cầm và động vật có vú. [13]

Một lý do chính cho việc sử dụng ADN ty thể (mtADN) là không có một sự tái tổ hợp của mtADN. Với tất cả các thành phần mã hóa của hệ gen ty thể mã hóa cho protein hoặc phân tử ARN liên quan đến hô hấp, người ta hi vọng rằng sẽ có một sự bảo vệ các trình tự khi bất kỳ một sự thay đổi nào ở protein hoặc phân tử ARN có thể tác động tiêu cực đến sinh vật. Không giống như hạt nhân, không có lỗi xảy ra trong việc đọc enzyme tồn tại trong ty thể để sữa chữa những gốc ADN được thêm vào một cách không chính xác trong suốt quá trình sao chép. Do vậy, sự tích tụ của những thay đổi cơ sở riêng lẻ trong ty thể là cao hơn gấp 5 lần so với những lỗi do sự sao chép trong hạt nhân. Ngoài ra có nhiều bản sao của ADN ty thể trên 1 tế bào so với 2 bản sao của ADN hạt nhân. Trong mỗi tế bào có nhiều ty thể phụ thuộc vào loại tế bào và trong mỗi ty thể có nhiều ADN ty thể. Các ty thể có một lớp protein để bảo vệ các mtADN khỏi sự phân hủy. Các vật liệu sinh học đã bị phân hủy cao , do đó, có khả năng tuân theo việc xác định kiểu mtADN nhiều hơn là sự cần thiết sinh ra một hồ sơ di truyền từ ADN hạt nhân khi xác định kiểu răng, xương hoặc tóc.[13]

*Vị trí gen được sử dụng trong phân loại

Các vị trí gen của sự lựa chọn cho nhận dạng pháp y các loài được dựa vào các nghiên cứu có nguồn gốc từ phân loại và cây phát sinh loài và chủ yếu được tìm thấy ở bộ gen ty thể. Trong phạm vi mtADN một số trình tự gen được cho là thể hiện ít sự biến đổi trong cùng chủng loại (trong các thành viên của cùng một loài) nhưng lại thể hiện đầy đủ sự biến đổi không trong chủng loại (giữa các loài khác nhau) để cho phép ước lượng về mức độ liên quan và số lần sai khác qua đồng hồ phân tử được hiệu chỉnh. Vị trí chính được sử dụng trong các nghiên cứu về phân loại và phát sinh chủng loại cho đến gần đây là gen cytocrome b (cyt b) cái mà xuất hiện giữa hai bazo 14747 và 15887 trong mtADN của người và mã hóa 1 protein có chiều dài 380 amino axit. Vị trí cyt b đã được sử dụng rộng rãi trong các nghiên cứu phân loại và pháp y, bao gồm các bộ phận cơ thể của hổ, trứng rùa, vỏ và da cá sấu, sừng tê giác, ngà voi, con công trống , mật gấu. Gần đây hơn, việc sử dụng gen cytochrome c oxidase I (COI) đã tăng lên chủ yếu do sự thông qua của tổ chức mã vạch của sự sống (Barcod of life consortium- CBOL). COI được tìm thấy giữa các bazo 5904 và 7945 ở mtADN người. COI ban đầu được sử dụng để nhận dạng các loài động vật không xương sống. Chẳng bao lâu sau nó đã trở thành vị trí lựa chọn trong côn trùng học pháp y để nhận dạng ấu trùng bọ cánh cứng trên xác chết. Vì đây là một vị trí có thể nhận dạng những loài này, nó đã được sử dụng nhiều hơn với mục tiêu trở thành vị trí được lựa chọn cho nhận dạng tất cả các loài động vật.[13]

Các vị trí gen khác trên hệ gen ty thể cũng đã được sử dụng trong nhận dạng một số loài. Chúng bao gồm các vị trí rARN 12s và 16s và họ gen NDH. D- loop (Displacement- loop) được sử dụng ít trong nhận dạng các loài nhưng nhiều hơn trong nhận dạng các loài trong cùng chủng loại. Bởi vì sự biến đổi lớn hơn ở các trình tự không được mã hóa, nó bây giờ đang được sử dụng như một công cụ để nhận dạng sự có mặt của một loài đặc biệt trong hỗn hợp nhiều loài khác nhau.[13]

*Các vị trí gen ty thể sử dụng trong phân loại

Quá trình nhận dạng các loài trong khoa học pháp y đang trở nên thường xuyên hơn nhưng vẫn chưa được chuẩn hóa tới một vị trí gen duy nhất. Bất chấp vị trí gen được sử dụng, quá trình tương tự không được biết, hoặc được đặt câu hỏi, mẫu vẫn được phân tích bằng cách khuếch đại một phần của gen, chủ yếu là một phần gen cyt b hoặc COI. Đoạn PCR (polymerase chain reaction) này sau đó được chạy trình tự một cách trực tiếp và trình tự ADN sẽ được so sánh với các trình tự ADN từ một ngân hàng dữ liệu mở như Genbank. Không chắc chắn rằng sẽ có một mẫu tham khảo từ một loài đã biết cho việc so sánh trực tiếp, vì vậy có một sự phụ thuộc vào dữ liệu trình tự ADN trên cơ sở dữ liệu. Genbank hiện có hơn 108 triệu trình tự (tháng 08/2009), và do đó, có một khả năng cao là mẫu chưa được biết sẽ phù hợp với một trình tự ADN từ một mẫu tham khảo được gửi lên cơ sở dữ liệu. Trong trường hợp có 100% sự tương đồng thì chúng ta có thể chắc chắn rằng mẫu không được biết là một thành viên của loài mà có trình tự ADN phù hợp với nó. Hình dưới đây chỉ ra sự tương thích của một trình tự của mẫu lấy từ khăn choàng được dệt từ lông của Linh Dương Tây Tạng (P. hodgsonii) với trình tự trên cơ sở dữ liệu của Genbank. Hình 14a và 14b dưới đây chỉ ra một phần nhỏ trình tự ADN gen cyt b và sự khác nhau cho 4 loài của chúng. Hình 14a chỉ ra cặp bazo 121- 241 của gen cyt b cho loài linh dương Tây Tạng (accession number AF034724) so với các loài động vật có vú với sự tương đồng gần nhất với một phần của trình tự; là cừu (Ovis aries: accession AB0068000), the Pyrenean Chamoix (Rupicapra pyrenaica: accession number AF034726) và một con dê (Capra sumatrensis: accession number AY669321). Trình tự chưa được biết đến từ một chiếc khăn choàng bị nghi ngờ là lấy từ bộ lông của linh dương Tây Tạng.[13]

Hình 14b cho thấy số lượng cặp bazo sai khác giữa bốn loài (đáy của hình tam giác) và tỷ lệ phần trăm tương tự qua 120 cặp. Thông thường người ta thường sử dụng trên 400 cặp bazo để tìm kiếm sự tương tự nhưng trên đây là nghiên cứu thử nghiệm nên chỉ sử dụng 120 cặp.

121 131 141 151 161 171 181



Unknown1 TTGGTTTTACAAATCCTAACAGGCCTATTCCTAGCAATACACTACACATCTGATACAACA

Pantholops TTGGTTTTACAAATCCTAACAGGCCTATTCCTAGCAATACACTACACATCTGATACAACA

Ovis TTAATTTTACAGATTCTAACAGGCCTATTCCTAGCAATACACTATACACCCGACACAACA

Rupricapra TTAATTTTACAGATCCTAACGGGCCTATTCCTAGCAATACACTACACATCTGACACAACA

Capra CTAATTCTACAAATCCTAACAGGCCTATTCCTAGCAATACACTACACATCCGATACAACG

182 191 201 211 221 231 241



Unknown1 ACAGCATTCTCTTCTGTAACCCACATTTGCCGAGATGTTAACTATGGCTGAATTATTCGA

Pantholops ACAGCATTCTCTTCTGTAACCCACATTTGCCGAGATGTTAACTATGGCTGAATTATTCGA

Ovis

ACAGCATTCTCCTCTGTAACCCACATTTGCCGAGACGTGAACTATGGCTGAATTATCCGA



Rupricapra ATAGCATTCTCCTCTGTAACCCACATTTGCCGAGATGTAAACTACGGCTGAATCATCCGA

Capra

ACAGCATTTTCTTCTGTAACACACATTTGCCGAGACGTAAACTATGGCTGAATTATCCGA



Hình14a: Đoạn gen cyt b từ cặp bazo 121-241 của bốn loài và loài chưa biết.




Pantholops

Ovis

Rupricapra

Capra

Unknown 1

Pantholops




90.00

91.67

90.84

100.00

Ovis

12




91.67

90.84

90.00

Rupricapra

10

10




88.33

91.67

Capra

11

11

14




90.84

Unknown 1

0

12

10

11




Hình 14b: So sánh số cặp bazo sai khác và % tương đồng qua 120 cặp bazo

Sự sẵn có của những cơ sở dữ liệu ADN được truy cập mở đã mang đến nhiều thuận lợi nhưng cũng luôn tồn tại những rủi ro nhất định. Điều này là bởi vì những trình tự ADN được đăng ký ở Genbank đã không yêu cầu rằng mẫu trước tiên phải đến từ mẫu vật chứng từ ví dụ như các mẫu từ viện bảo tàng cái mà được coi như mẫu chứng từ đã đã được phát hiện là nhầm lẫn. Chẳng hạn như trong một nghiên cứu về nấm người ta đã phát hiện ra rằng có khoảng 20% các trình tự được đăng ký có thể bị xác định nhầm. Tuy nhiên các cơ sở dữ liệu trực tuyến và công cộng đang phát triển theo một tốc độ cấp số nhân, nhiều trình tự hơn sẽ được thêm vào cơ sở dữ liệu.và quan trọng hơn nhiều trình tự từ các loài giống nhau được thêm vào, điều này làm cho chúng ta dễ dàng nhận dạng hơn và có thể loại bỏ các trình tự nhầm lẫn. Nếu bất kỳ trình tự nào có sự sai khác lớn nhất với các trình tự khác thì trình tự khác thường này sẽ nằm ở cuối trong danh sách. Điều này không chỉ cho thấy lợi ích của việc có nhiều trình tự khác nhau cho cùng một loài mà còn chỉ ra khả năng sẽ nhận dạng nhầm nếu chỉ có một trình tự cho một loài cụ thể ở một vị trí gen cụ thể.[13]

Nếu các trình tự ADN từ các mẫu không được biết cho thấy một sự phù hợp 100% với trình tự tham khảo cho P. hodgsonii và 84% với loài gần nhất tiếp theo thì có thể chắc chắn rằng mẫu chưa được biết chính là Linh Dương Tây Tạng. Sự chắc chắn này đã đặt ra câu hỏi mẫu đến từ Linh dương Tây Tạng và không phải là một số loài khác giả sử như: (1) tất cả các loài được đưa ra trên cơ sở dữ liệu và không có một loài nào có cùng trình tự ADN được phân tích, (2) tất cả các thành viên của Linh dương Tây Tạng có cùng một trình tự ADN như đã được đăng ký trên Genbank (không có biến dị trong cùng loài) và (3) dữ liệu trình tự cho loài gần nhất tiếp theo (theo hình trên là loài dê) cũng là đại diện cho loài này và không một thành viên nào của loài này, ngẫu nhiên, có trình tự tương tự như trình tự của mẫu được yêu cầu. Cho đến gần đây vẫn chưa có một nghiên cứu nào định lượng biến thể trong loài trong phạm vi các vị trí gen được sử dụng cho nhận dạng loài. Một nghiên cứu như vậy sẽ giải quyết các giả định trên và cung cấp một giá trị cho sự chắc chắn về sự phù hợp 100%. Nó cũng sẽ giải quyết vấn đề liên quan tới sự phù hợp 99% hoặc nhỏ hơn để xác định liệu bất kỳ sự biến đổi trình tự có phải là do biến dị trong loài hay không.[13]

Trường hợp của cyt b và COI các việc thực hành nhìn chung là để khuếch đại một phần gen cho việc phân tích trình tự. Hơn nữa, nhiều mẫu được kiểm tra có thể ở dạng vết, có nhiều chất ức chế quá trình PCR, và bị phân hủy cao. Trong trường hợp đoạn cyt b của gen được sử dụng thông thường là 400 bazo đầu tiên và trong trường hợp sử dụng COI là khoảng 600 cặp và không ít hơn 500 bazo.



*Sự biến đổi trong loài và khác loài gen Cyt b và COI

Bằng cách sử dụng mô hình2 tham số Kimura (K2P- Kimura 2-parameter model), nhìn chung các tác giả nhận định rằng sự thay đổi trong cùng loài nằm trong phạm vi < 2-3% (giữa 7.93% và 0.43% với loài chim cho COI; giữa 5.7% và 1.5% với loài Stenella cho Cyt b). Khi những bất thường nảy sinh, điều này được hiểu là các loài ẩn sinh mặc dù các loài ẩn sinh này có thể được dựa vào biến đổi trong loài từ chỉ 2 cá thể. Ví dụ cụ thể này liên quan đến một loài chim Bắc mỹ. Một nghiên cứu được thực hiện bởi Kartavtsev và Lee đã điều tra các loại nucleotit giữa cyt b và COI ở mức độ loài, chi và quần thể. Họ đã phân tích một phạm vi rộng của các loài động vật có xương sống và không có xương sống nhưng đã hợp nhất tất cả các kết quả mà không tách biệt thành các lớp khác nhau. Họ đã xác định rằng bất kỳ hai mẫu nào gần gũi hơn dựa theo phân loại, chúng sẽ gần gũi hơn về mặt di truyền dựa theo khoảng cách – p (tương tự K2P nhưng không có sự phân biệt giữa xác suất cho sự chuyển tiếp và sự chuyển đổi như hình dưới). Các nghiên cứu của Kartavtsev và Lee đã chỉ ra rằng các giá trị được đề nghị cho cả hai gen này xuất hiện là chính xác. Tuy nhiên, rõ ràng chúng ta có thể thấy được có một sự chồng chéo giữa sự biến đổi trong loài và khác loài của COI với các loài anh chị em.





Hình 15: Một minh họa cho sự thay đổi dựa vào khoảng cách – P của cả hai vị trí gen cyt b (màu đen) và COI (màu đỏ) bằng cách sử dụng các nhóm động vật phân loại khác nhau. Nhóm 1 là những thay đổi trong phạm vi một loài; nhóm 2 là biến đổi giữa các loài anh chị em; nhóm 3 là thay đổi giữa các loài trong phạm vi cùng một chi và nhóm 4 là biến đổi giữa các loài trong các chi khác nhau nhưng cùng một họ. Hình vuông trung tâm chỉ ra giá trị trung bình, hộp lớn hơn là sai số chuẩn (SE) ± 1.00 và các vạch ở các phía của hộp thể hiện sai số chuẩn ± 1.96. Đồ thị này thì được chuyển thể từ kết quả nghiên cứu của Kartavtsev và Lee.

Một nghiên cứu gần đây của Tobe et al, điều tra chỉ ở nhóm động vật có vú với các trình tự gen Cyt b và COI đã được so sánh cho 217 loài động vật có vú khác nhau để đánh giá sự biến đổi của các loài khác loài, 945 người, 130 gia súc nuôi trong nhà và 35 chó nuôi trong nhà để đánh giá biến dị trong cùng loài. Những dữ liệu này đã chỉ ra một khoảng cách giữa sự thay đổi được nhìn thấy lớn nhất trong cùng loài (1.5%) với sự thay đổi gần nhất khác loài (2.5%), dựa trên giá trị K2P. Một ngưỡng có thể ứng dụng cho việc đưa ra dự đoán về sự biến đổi lớn nhất trong và khác loài.

Bằng cách liên kết tất cả các bộ dữ liệu lại với nhau, gần 1 triệu so sánh K2P đã được thực hiện. Kết quả của họ chỉ ra rằng mặc dù cả hai loài thì tương tự nhau trong khả năng phân biệt các loài cụ thể, cyt b đã thể hiện tốt hơn so với COI. Một ngưỡng K2P ở 1.5 chỉ ra rằng, với COI, tỷ lệ sai số dương là 4.85x10-4 và giá trị dương dự đoán là 0.9995, trong khi đó với cyt b, tỷ lệ sai số dương tính là 2.02x10-4 và giá trị dương được dự đoán là 0.998. Những số liệu này chỉ ra rằng cả hai vị trí gen đã thể hiện một độ chắc chắn cao trong việc nhận dạng các loài nếu dữ liệu nằm trong ranh giới cùng loài nhưng thậm chí khả năng nhầm lẫn là ít hơn nếu sử dụng cyt b. Như là một thí nghiệm mở rộng của 2 gen, Tobe at el đã xây dựng các cây phát sinh loài bằng cách sử dụng dữ liệu trình tự cho mỗi gen. Họ đã nhận thấy rằng với bất cứ phương pháp cây nào được sử dụng, một số loài luôn luôn bị đặt nhầm chỗ. Nhìn chung, gen Cyt b đã cho thấy một sự xây dựng lại chính xác hơn về phát sinh loài các loài động vật có vú hơn COI ở cấp độ họ, bộ và trên bộ.

*Báo cáo kết quả-hiện tại và tương lai

Trong trường hợp thiếu kiến thức về biến dị trong loài và khác loài, có một hạn chế để chắc chắn rằng các kết quả của các thử nghiệm trình tự có thể nhận dạng loài. Hiện tại, nếu có sự tương đồng 100% giữa trình tự tham khảo và trình tự được yêu cầu, có hai khả năng xảy ra. Hoặc là mẫu được yêu cầu đến từ một loài mà tương thích hoặc tình cờ tương thích và đến từ một loài không được biết mà chỉ tình cờ có trình tự ADN như loài được yêu cầu. Nếu không có sự phù hợp 100% với bất kỳ trình tự nào trên cơ sở dữ liệu nhưng có 99.5% sự tương đồng với một trình tự với 2 bazo khác nhau giữa 2 trình tự trên tổng chiều dài 400 bazo và loài gần nhất tiếp theo có 96% sự tương đồng, vậy thì có hai khả năng là: (1) hoặc là mẫu được yêu cầu đến từ loài mà có 99.5% sự tương đồng với nó và sự sai khác là do biến đổi trong loài hoặc (2) nó đến từ một loài chưa được biết nhưng có sự tương đồng 99.5% với loài có quan hệ họ hàng gần nhất mà chưa được ghi nhận trên cơ sở dữ liệu.

Tuy nhiên có nhiều báo cáo về kiểu dữ liệu này sẽ xem xét đến khả năng biến đổi trong loài cao như thế, như thể hiện 96% sự tương đồng cho các vị trí gen như cyt b và COI, điều này thật khó để là sự thay thế đáng tin cậy cho các mẫu được yêu cầu có sự tương đồng 99.5%. Đây chỉ có thể là một giả định cho các nghiên cứu mà thôi. Với những kiến thức về biến đổi trong loài và khác loài được nêu chi tiết ở phần trên, ba kịch bản trên có thể được giải quyết với một xác suất. Trong tất cả các loài động vật có vú được kiểm tra, có một khoảng cách rõ ràng giữa biến đổi trong loài và khác loài. Một sai số âm và dương có thể được trích dẫn cho phép một sự chắc chắn rằng mẫu được yêu cầu là thành viên của loài mà nó có sự tương đồng 99.5%.[13]

Phương pháp thử nghiệm các loài hiện tại đang dựa vào sự so sánh các trình tự của một vị trí gen ty thể: chủ yếu là vị trí cyt b hoặc COI. Những phương pháp mới về tạo trình tự ADN đã mở ra tiềm năng trong việc chạy trình tự toàn bộ hệ gen.


1.4.3.Việc áp dụng phương pháp sinh học phân tử trên thế giới


Tổ chức iBOL đã tổ chức các cộng tác viên từ hơn 150 quốc gia để tham gia vào các chiến dịch điều tra tính đa dạng của các loài động vật và thực vật bao gồm: kiến, ong, bướm, cá, chim, động vật có vú, nấm và thực vật có hoa trong phạm vi các hệ sinh thái bao gồm: biển, rừng mưa nhiệt đới, rừng tảo bẹ, rạn san hô, các vùng cực. Cuộc tổng điều tra về đời sống ở biển đã kéo dài mười năm và kết thúc vào năm 2010, đã cung cấp một danh sách toàn diện đầu tiên của hơn 190000 loài ở biển và đã xác định được 6000 loài mới. Có một mức độ đáng ngạc nhiên về mức độ đa dạng sinh học, được hiện hữu trước mắt chúng ta. Ví dụ, mã vạch ADN đã chỉ ra rằng một con bướm nâu nổi tiếng (Astraptes fulgerator) được xác định 1775, thực sự là 10 loài riêng biệt. Mã vạch ADN đã cách mạng hóa việc phân loại hoa lan, một họ thực vật phức tạp và phổ biến rộng rãi với ước tính khoảng 20000 loài. Môi trường đô thị cũng đa dạng một cách đáng ngạc nhiên, mã vạch ADN đã được sử dụng để ghi vào danh mục 24 loài bướm và 54 loài ong ở các công viên công cộng trong thành phố New York. Mã vạch ADN cũng được sử dụng để phát hiện các vụ gian lận thực phẩm và các sản phẩm từ các loài được bảo tồn. Làm việc với các nhà nghiên cứu từ đại học Rockefeller và bảo tàng lịch sử tự nhiên Hoa kỳ, các sinh viên trường trung học Trinity đã phát hiện ra rằng 25% trong số 60 loại hàng hóa hải sản được mua trong các cửa hàng tạp hóa và nhà hàng ở New York bị nhầm là loại đắt tiền hơn. Một loài cá bị dán nhãn sai là loài có nguy cơ tuyệt chủng - cá hồi đỏ Acadia. Một nhóm khác đã xác định được ba loài cá voi được bảo vệ là nguồn của món shusi được bán ở Caliphonia và Hàn Quốc. Tuy nhiên việc sử dụng mã vạch ADN để nhận dạng các vụ buôn lậu sinh học tiềm ẩn giữa các sản phẩm bị tịch thu bởi hải quan vẫn trong giai đoạn bước đầu.[15]


: files -> ChuaChuyenDoi
ChuaChuyenDoi -> ĐẠi học quốc gia hà NỘi trưỜng đẠi học khoa học tự nhiên nguyễn Thị Hương XÂy dựng quy trình quản lý CÁc công trìNH
ChuaChuyenDoi -> TS. NguyÔn Lai Thµnh
ChuaChuyenDoi -> Luận văn Cao học Người hướng dẫn: ts. Nguyễn Thị Hồng Vân
ChuaChuyenDoi -> 1 Một số vấn đề cơ bản về đất đai và sử dụng đất 05 1 Đất đai 05
ChuaChuyenDoi -> TRƯỜng đẠi học khoa học tự nhiên nguyễn Hà Linh
ChuaChuyenDoi -> ĐÁnh giá Đa dạng di truyền một số MẪu giống lúa thu thập tại làO
ChuaChuyenDoi -> TRƯỜng đẠi học khoa học tự nhiêN
ChuaChuyenDoi -> TRƯỜng đẠi học khoa học tự nhiên nguyễn Văn Cường
ChuaChuyenDoi -> ĐÁnh giá thực trạng và ĐỀ xuất giải pháP


1   2   3   4   5   6   7   8   9   ...   13


Cơ sở dữ liệu được bảo vệ bởi bản quyền ©hocday.com 2019
được sử dụng cho việc quản lý

    Quê hương