Luận văn Cao học Người hướng dẫn: ts. Nguyễn Thị Hồng Vân



tải về 318.47 Kb.
trang3/4
Chuyển đổi dữ liệu07.07.2016
Kích318.47 Kb.
1   2   3   4

2.2. PHƯƠNG PHÁP NGHIÊN CỨU

2.2.1. Thu thập và bảo quản mẫu

Mẫu mô của 42 bệnh nhân mắc ung thư đại trực tràng, dạ dày và 5 mẫu đối chứng được thu thập, bảo quản trong các ống chuyên dụng ở điều kiện -200C, có đánh số thứ tự và ghi lý lịch mẫu rõ ràng.



2.2.2. Tách ADN tổng số

ADN tổng số từ 42 mẫu mô bệnh phẩm và 5 mẫu đối chứng được tách chiết theo quy trình hướng dẫn kèm theo trong bộ Kit tinh sạch ADN tổng số của hãng JMC R & D - Hàn Quốc.



2.2.3. Xác định độ tinh sạch và hàm lượng ADN tổng số

  1. Điện di trên gel agarose 0,8%

ADN tổng số được kiểm tra bằng phương pháp điện di trên gel agarose 0,8% pha trong đệm TAE 1X và chạy ở hiệu điện thế 80V. Thang chuẩn ADN được sử dụng là λ/HindIII. Nếu trên bản gel điện di chỉ thấy xuất hiện 1 băng sáng duy nhất có kích thước tương ứng với băng lớn nhất của marker chứng tỏ ADN tổng số đã được tách chiết thành công.

  1. Đo mật độ quang phổ hấp thụ

Để xác định độ tinh sạch và hàm lượng ADN tổng số thu được, chúng tôi tiến hành đo mật độ quang phổ hấp thụ ở 2 điểm có bước sóng 260nm và 280nm. Nếu tỷ số OD260/280 nằm trong khoảng 1,8 – 2 chứng tỏ ADN là sạch và đủ tiêu chuẩn làm nguyên liệu tiến hành phản ứng PCR. Các mẫu ADN tổng số đạt tiêu chuẩn về độ tinh sạch là các mẫu có giá trị OD260/280 nằm trong khoảng 1,8 – 2. Pha loãng các mẫu ADN với nước khử ion tới nồng độ 100 μg/ml và bảo quản cẩn thận trong tủ lạnh ở nhiệt độ - 200C để phục vụ cho các bước thí nghiệm tiếp theo.

2.2.4. Nhân bản các exon nhờ phản ứng PCR

2.2.4.1. Thiết kế mồi

Các cặp mồi đặc hiệu sử dụng trong nhân bản các exon được thiết kế bởi công cụ “Primer blast” của NCBI (http://www.ncbi.nlm.nih.gov/tools/primer-blast/). Các exon được nhân bản bao gồm toàn bộ exon và một phần trình tự intron chặn 2 đầu. Chi tiết các cặp mồi thiết kế được trình bày cụ thể trong Bảng 6.



Bảng 6: Trình tự các cặp mồi dùng để nhân bản 09 exon quan tâm

Tên exon và

kích thước (bp)

Trình tự mồi

(F: Forward – mồi xuôi; R: Reverse – mồi ngược)

Sản phẩm PCR (bp)

Exon 2 (155)

F-5’TGAAGTCCAGCTAATACAGTGC-3’

345

R-5’GTGTCTCAAACCATTCTACTATCA-3’

Exon 3 (279)

F-5’CTTAGGCTTCTCCTGGCAATCTCTC-3’

281

R-5’TCTCAGTTTCCCCATGTCTCCAGCA-3’

Exon 6 (150)

F-5’TGTTCCTCTGTTTTTCATGGCG-3’

279

R-5’TGGTATAATCATGTGGGTAACTGC-3’

Exon 7 (200)

F-5’GTTGAGACTTACGTGCTTAGTTGAT-3’

351

R-5’TGAGGACAGCACATTGCCAAG-3’

Exon 8 (110)

F-5’GTAACTTTGGAGACCTGCTGTACT-3’

365

R-5’CATCCACTGTCCACAAAGGTGCT-3’

Exon 12 (246)

F-5’GGGGGATTAAATGTATTTTTACGGC-3’

369

R-5’AACGTTACCCCCACAAAGCC-3’

Exon 13 (205)

F-5’ATATAATTTGTTTTGTAGGCCCCA-3’

244

R-5’GGGACTAGGAGATGCACTTACC-3’

Exon 14 (248)

F-5’TGTAATTATGTGCTTCAGGTCTGC-3’

315

R-5’AGTTTCCCATTACCAAGTTCTGA-3’

Exon 15 (176)

F-5’TCTCATGCTGTCCCCTCACG-3’

235

R-5’TGAAAACAAACTGACAAACCTCTCT3’

2.2.4.2. Tiến hành phản ứng PCR

Thành phần cũng như chu trình nhiệt của một phản ứng PCR được thể hiện trong Bảng 7.



Bảng 7: Thành phần và chu trình nhiệt cho một phản ứng PCR

Thông số các thành phần phản ứng PCR

Chu trình nhiệt

Thành phần phản ứng PCR

Nồng độ ban đầu

Thể tích sử dụng (µl)

Giai đoạn

Nhiệt độ (t0C)

Thời gian

ADN tổng số

~100ng/µl

4

Biến tính khởi động

94

5 phút

Buffer (Mg2+)

10X

4

Biến tính khuôn

94

30 giây

dNTPs

2mM

4

Gắn mồi (*)

50 – 58

30 – 45 giây

Mồi xuôi (F)

10µg/ml

1.5

Kéo dài chuỗi

72

30 giây

Mồi ngược(R)

10µg/ml

1.5

Ổn định

72

5 phút

Taq-ADN pol

1u

1.5

Bảo quản

4



H2O khử ion




33.5

Số chu kỳ

30

Tổng thể tích

50µl

(*): Thông số có thể thay đổi tùy exon

2.2.5. Kỹ thuật SSCP trong phân tích đột biến gây ung thư đại trực tràng

SSCP là kỹ thuật phân tích đột biến dựa vào tính đa hình trong cấu trúc sợi đơn của phân tử ADN khi chúng có sự biến đổi so với trạng thái bình thường mà chúng thể hiện (Hình 9). Phương pháp này được mô tả lần đầu bởi Orita và cộng sự năm 1989 (xem thêm Mục 1.5.3 đã đề cập ở trên). Tuy nhiên, chúng tôi đã cải tiến một vài điều kiện thí nghiệm như dung dịch biến tính, thời gian và điện thế chạy cho phù hợp với điều kiện thí nghiệm nhằm nâng cao độ tin cậy cho các kết quả nghiên cứu.

Mẫu ADN từ sản phẩm PCR của các exon tương ứng, lấy ra khoảng 3 – 5µl và trộn với 16 – 18µl dung dịch biến tính LIS. Đây thực chất là một loại đệm biến tính có nồng độ ion thấp, chứa 10% sucrose. Sau đó, hỗn hợp này được đem biến tính ở 950C trong khoảng 10 phút và đưa nhanh ra đá lạnh trong 5 phút với mục đích gây sốc nhiệt, tạo điều kiện thuận lợi cho sự biến tính giải phóng sợi đơn của phân tử ADN. Tiếp theo, mẫu đã biến tính được nạp lên các giếng đã được tạo sẵn trên bản gel polyacrylamide không biến tính 12% (PAGE 12%) trong hệ thống điện di và chạy trong khoảng thời gian từ 6 – 18h ở điện thế khoảng 6 – 10V/cm tùy vào kích thước mỗi exon cũng như điện thế dòng điện sử dụng. Tuy nhiên, trong đề tài này, mẫu đã biến tính được chạy điện di qua đêm ở điện thế 7V/cm và PAGE 12% pha với tỷ lệ các thành phần được thể hiện trong Bảng 8 dưới đây.

Bảng 8: Tỷ lệ các thành phần của PAGE 12% trong kỹ thuật SSCP


Thành phần

Nồng độ

Acrylamide: Bis-Acrylamide (49:1)

12%

TAE

1X

Glycerol

5 – 10%

Nước

Vừa đủ

Lưu ý:

Khi tiến hành kỹ thuật SSCP ở nhiệt độ phòng cần bổ sung glycerol 10% vào thành phần của gel. Nếu tiến hành trong môi trường nhiệt ổn định 40C thì không nhất thiết phải bổ sung glycerol.

Sau khi điện di, cẩn thận gỡ gel ra khỏi bản kính và tiến hành ngay bước nhuộm bạc. Sản phẩm điện di được sử dụng quy trình nhuộm bạc nhanh (khoảng 15 – 20 phút) của Z. W. An và cộng sự [10] với 3 bước cơ bản và thành phần 3 dung dịch nhuộm tương ứng được mô tả trong Bảng 9.

Bảng 9: Quy trình nhuộm bạc và thành phần các dung dịch nhuộm

Bước 1: Tiến hành khoảng 5 đến 10 phút với dung dịch I

Bước 2: Tiến hành khoảng 3 đến 5 phút với dung dịch II

Bước 3: Tiến hành khoảng 3 đến 5 phút với dung dịch III

Thành phần dung dịch I

Thể tích sử dụng (ml)

Thành phần dung dịch II

Thể tích sử dụng (ml)

Thành phần dung dịch III

Thể tích sử dụng (ml)

Ethanol 95%

11

NaOH 6M

10.8

Ethanol 95%

11

HNO3

3.8

Na2CO3.10H2O

3.5 (g)

HNO3 65%

3.08

AgNO3

0.2 (g)

HCHO 30%

2.4

H2O

Vừa đủ

H2O

Vừa đủ

H2O

Vừa đủ

Ʃ VIII: 200ml

Ʃ VI: 200ml

Ʃ VII: 200ml

Lưu ý:

Sau bước nhuộm với dung dịch I, dùng nước cất để làm sạch phần dịch nhuộm vừa sử dụng trong 10 – 15 giây trước khi tiến hành bước nhuộm làm hiện băng điện di với dung dịch II. Cuối cùng, sử dụng dung dịch III để cố định các băng hiện trên bản gel và mang bản gel đi soi với máy soi gel dưới nguồn ánh sáng trắng, phân tích kết quả và chụp ảnh.



2.2.6. Giải trình tự ADN

Đây là phương pháp được ứng dụng để đọc trình tự một đoạn ADN với một kích thước nhất định dựa vào sắc đồ bắt màu của các bazơ nitơ. Tuy không có ý nghĩa trong sàng lọc đột biến nhưng nó là khâu cuối cùng khẳng định đột biến có thực sự xảy ra. Hơn nữa, phương pháp này còn cho biết chính xác vị trí xảy ra đột biến. Cùng một số phần mềm hỗ trợ phân tích kết quả giải trình tự như BioEdit, Xplorer v2.4.2 và Genetyx-Win 4.0 các dạng đột biến cũng được phát hiện.

Phương pháp này tuy tốn kém nhưng cho hiệu quả cao trong việc khẳng định kết quả nghiên cứu. Giải trình tự ADN cũng là phương pháp không thể thiếu trong những nghiên cứu liên quan đến phân tích di truyền ở cấp độ phân tử như phát hiện đột biến, phân biệt, định danh các loài.

Với những mẫu có mô hình điện di sai khác được chỉ ra nhờ kỹ thuật PCR-SSCP, chúng tôi tinh sạch và làm giàu nồng độ bằng phản ứng PCR trước khi gửi mẫu đi giải trình tự. Kết quả giải trình tự các phân đoạn gen trong mẫu bệnh nhân được phân tích bằng phần mềm BioEdit và Genetyx-Win 4.0 và được so sánh với trình tự tương ứng từ mẫu đối chứng.



Chương 3. KẾT QUẢ VÀ THẢO LUẬN

3.1. KẾT QUẢ TÁCH CHIẾT ADN TỔNG SỐ

ADN tổng số được tinh sạch theo quy trình hướng dẫn đi kèm trong bộ Kit tách chiết. Sau khi tiến hành các thao tác được chỉ dẫn, chúng tôi đã thu được sản phẩm ADN tổng số từ 42 mẫu bệnh phẩm tương ứng và ADN tổng số của 5 mẫu đối chứng (Hình 10). Sản phẩm tách chiết được điện di trên gel agarose 0,8%, pha và điện di trong môi trường đệm TAE 1X khoảng 40 – 45 phút với điện thế nguồn 80V. Nhờ thang chuẩn λ/HindIII làm chỉ thị, chúng tôi thu được một băng duy nhất trên bản gel với kích thước xấp xỉ 23,1Kb. Kết quả cho thấy, ADN tổng số đã được tách chiết thành công.

Nhìn vào Hình 10 ta thấy, ADN tổng số thu được có chất lượng khá đồng đều ở hầu hết các mẫu. Cụ thể, các băng ADN có độ sáng cao, gọn và sắc nét, không bị đứt gãy, lẫn rất ít hoặc không lẫn ARN. Sau khi đo hàm lượng ADN nhờ hệ thống máy đo quang phổ hấp thụ tại 2 điểm có bước sóng lần lượt là 260nm và 280nm, chúng tôi thu được chỉ số OD260/280 dao động trong khoảng 1,6 – 2, tương ứng với hàm lượng ADN trong khoảng 300 – 500 µg/ml. Đây là những chỉ số phù hợp với yêu cầu về chất lượng ADN cho các bước thí nghiệm tiếp theo. Các mẫu ADN tổng số thu được được pha loãng với nước khử ion tới nồng độ 100µg/ml và bảo quản trong tủ lạnh ở nhiệt độ -200C.

3.2. KẾT QUẢ NHÂN BẢN 09 EXON GEN MSH2

Với những hiểu biết cơ bản về nguyên lý hoạt động của phản ứng PCR, tối ưu hóa được thành phần phản ứng, tìm được điểm gắn mồi phù hợp cho mỗi exon, chúng tôi đã nhân bản thành công các exon quan tâm. Kết quả nhân bản 09 exon bao gồm exon 2, 3, 6, 7, 8, 12, 13, 14, 15 được chúng tôi kiểm tra nhờ phương pháp điện di trên gel agarose 1,2% pha và chạy trong môi trường đệm TAE 1X ở điện thế nguồn 90V với thời gian khoảng 30 phút. Nhờ thang chuẩn marker 100bp làm chỉ thị, chúng tôi đã thu được sản phẩm nhân bản có kích thước phù hợp với từng exon tương ứng. Chi tiết kết quả nhân bản các exon được thể hiện trong các hình từ Hình 11 – 19.



3.2.1. Kết quả nhân bản exon 2

Exon 2 được chúng tôi tiến hành tối ưu hóa điều kiện nhiệt độ gắn mồi từ 500 đến 520C, chia thành 5 điểm là 500C, 50.50C, 510C, 51.50C, 520C. Trong đó, ở điểm nhiệt 500, ngoài băng chính có kích thước 345bp, chúng tôi thấy xuất hiện thêm một băng sản phẩm phụ kích thước >345bp. Với 3 điểm nhiệt 50.50C, 510C, 51.50C chỉ có duy nhất 1 băng có kích thước xấp xỉ 345bp. Nhưng ở điểm nhiệt 510C băng ADN thể hiện độ sáng cao nhất. Chúng tôi đã quyết định sử dụng điểm nhiệt độ gắn mồi 510C trong nhân bản exon 2. Sau khi nhân bản đồng loạt các mẫu, kết quả điện di được thể hiện như Hình 11. Kết quả cho thấy, exon 2 gen MSH2 của 42 mẫu bệnh phẩm đã được chúng tôi nhân bản thành công.





3.2.2. Kết quả nhân bản exon 3

Exon 3 được chúng tôi tối ưu hóa điều kiện nhiệt độ gắn mồi trong dải nhiệt từ 560 đến 580C, chia thành 5 điểm là 560C, 56.50C, 570C, 57.50C, 580C . Ở điểm nhiệt 560C ngoài băng chính với kích thước khoảng 281 bp chúng tôi thấy xuất hiện 1 băng phụ phía trên với kích thước >900 bp. Ở 3 điểm nhiệt còn lại là 56.50C, 570C và 57.50C chỉ có duy nhất 1 băng ADN với kích thước đúng yêu cầu của sản phẩm nhân bản. Tuy nhiên, trong 3 điểm nhiệt thử nghiệm có cùng kết quả này chúng tôi thấy, băng ADN có độ sáng cao nhất thuộc điểm nhiệt 570C. Vì vậy, chúng tôi quyết định chọn điểm nhiệt 570C làm nhiệt độ gắn mồi nhân bản exon 3 và không thử nghiệm với điểm nhiệt 580C. Các mẫu được nhân bản thành công với kết quả điện di được thể hiện như Hình 12. Kết quả điện di cho thấy, exon 3 đã được chúng tôi nhân bản thành công với kích thước sản phẩm đúng theo tính toán lý thuyết được đề cập trong Bảng 6.





3.2.3. Kết quả nhân bản exon 6

Căn cứ vào tỷ lệ GC trong trình tự mồi kết hợp với tính toán lý thuyết nhiệt độ gắn mồi, chúng tôi đã xác định, dải nhiệt độ gắn mồi để nhân bản exon 6 nằm trong khoảng từ 520C đến 530C, chia thành 3 điểm là 520C, 52.50C và 530C. Ở điểm nhiệt 520C, ngoài băng chính với kích thước xấp xỉ 279bp còn xuất hiện 1 băng phụ phía dưới kích thước >150bp. Với điểm 52.50C, băng phụ mờ hơn, băng chính lên sáng rõ. Ở điểm nhiệt cuối cùng là 530C, chúng tôi thu được duy nhất 1 băng với kích thước ~279bp. Chúng tôi đã quyết định sử dụng điểm nhiệt 530C làm nhiệt độ gắn mồi trong nhân bản exon 6. Kết quả điện di sản phẩm nhân bản exon 6 của các mẫu được thể hiện như Hình 13.





3.2.4. Kết quả nhân bản exon 7

Trong nhân bản exon 7, khi so sánh độ dài, tỷ lệ %GC của mồi và kích thước exon nhân bản chúng tôi thấy tương đối giống exon 12. Vì thế, chúng tôi quyết định chọn điểm nhiệt độ gắn mồi trong nhân bản exon 7 là 560C (giống với nhiệt độ gắn mồi exon 12 mục 3.2.6). Kết quả điện di cho thấy, ở 560C chúng tôi thu được 1 băng ADN duy nhất với kích thước khoảng 351bp. Điều đó khẳng định, exon 7 đã được chúng tôi nhân bản thành công. Kết quả nhân bản exon 7 cho 42 mẫu nghiên cứu được thể hiện như Hình 14.





3.2.5. Kết quả nhân bản exon 8

Căn cứ vào trình tự mồi cũng như nhiệt độ gắn mồi tính toán theo lý thuyết, chúng tôi dự kiến nhiệt độ gắn mồi trong nhân bản exon 8 nằm trong dải từ 540C đến 560C. Tiến hành thử nghiệm với 3 điểm nhiệt là 540C, 550C và 560C, chúng tôi thu được kết quả như sau: ở 540C, ngoài băng ADN có kích thước khoảng 365bp còn xuất hiện 1 băng phụ mờ với kích thước >100bp; ở 550C chỉ xuất hiện 1 băng ADN duy nhất có kích thước khoảng 365bp; ở 560C không còn băng ADN nào được thể hiện. Điều đó chứng tỏ, 550C là điểm nhiệt gắn mồi tối ưu trong nhân bản exon 8. Hình 15 là kết quả nhân bản exon 8 cho 42 mẫu nghiên cứu.





3.2.6. Kết quả nhân bản exon 12

Exon 12 được tối ưu hóa điều kiện nhiệt độ gắn mồi nằm trong dải từ 550C đến 570C với 4 điểm nhiệt được thử nghiệm là 550C, 560C, 56.50C và 570C. Ở điểm nhiệt 550C, băng ADN chính với kích thước khoảng 369bp lên sáng rõ nhưng ngoài ra xuất hiện 2 băng phụ mờ (trong đó 1 băng có kích thước >250bp và 1 băng có kích thước <100bp). Khi tăng nhiệt độ gắn mồi lên 560C thì băng phụ kích thước >250 bp không còn xuất hiện, chỉ còn băng <100bp. Chúng tôi nhận định đây có thể là lượng mồi còn dư sau thử nghiệm. Vì ở điểm nhiệt 56.50C băng chính không còn xuất hiện, chỉ có băng <100bp được thể hiện. Chúng tôi không tiến hành thử nghiệm ở điểm nhiệt độ 570C và chọn 560C làm nhiệt độ gắn mồi tối ưu trong nhân bản exon 12. Ngoài ra, để hạn chế sự xuất hiện băng ADN kích thước <100bp, chúng tôi giảm lượng mồi bổ sung trong thành phần phản ứng. Điều kiện thử nghiệm cũng như kết quả nhân bản exon 12 của các mẫu được thể hiện như Hình 16.





3.2.7. Kết quả nhân bản exon 13

Dựa trên những tính toán lý thuyết về nhiệt độ gắn mồi của exon 13, chúng tôi dự kiến nhiệt độ gắn mồi nhân bản exon 13 nằm trong dải từ 530C đến 540C. Thử nghiệm với 3 điểm nhiệt gắn mồi là 530C, 53.50C và 540C, chúng tôi thu được kết quả như sau: ở điểm nhiệt 530C ngoài băng ADN chính mờ với kích thước 244bp còn xuất hiện 1 băng phụ mờ với kích thước ~400bp; ở điểm nhiệt 53.50C băng phụ kích thước ~400bp không còn nhưng băng chính vẫn mờ; ở điểm nhiệt 540C băng ADN chính lên sáng rõ và không xuất hiện băng phụ nào. Vì vậy, chúng tôi quyết định chọn điểm nhiệt 540C làm nhiệt độ gắn mồi tối ưu trong nhân bản exon 13. Hình 17 cho thấy, exon 13 đã được chúng tôi nhân bản thành công.





3.2.8. Kết quả nhân bản exon 14

Chúng tôi tiến hành tối ưu hóa điều kiện nhiệt độ găn mồi exon 14 trong dải từ 510C đến 530C và được thử nghiệm ở 3 điểm nhiệt là 510C, 520C và 530C. Trong 3 điểm nhiệt thử nghiệm này, chúng tôi quyết định sử dụng điểm nhiệt 520C để nhân bản exon 14. Vì ở điểm nhiệt này, chúng tôi thu được sản phẩm PCR đúng với kích thước mong muốn ~315bp với độ sáng cao, không có băng phụ xuất hiện. Kết quả nhân bản exon 14 cho các mẫu được thể hiện như Hình 18.




1   2   3   4


Cơ sở dữ liệu được bảo vệ bởi bản quyền ©hocday.com 2016
được sử dụng cho việc quản lý

    Quê hương